%PDF-1.7 % 6 0 obj << /Type /Page /Parent 1 0 R /LastModified (D:20200119164553+01'00') /Resources 2 0 R /MediaBox [0.000000 0.000000 595.276000 841.890000] /CropBox [0.000000 0.000000 595.276000 841.890000] /BleedBox [0.000000 0.000000 595.276000 841.890000] /TrimBox [0.000000 0.000000 595.276000 841.890000] /ArtBox [0.000000 0.000000 595.276000 841.890000] /Contents 7 0 R /Rotate 0 /Group << /Type /Group /S /Transparency /CS /DeviceRGB >> /Annots [ 5 0 R ] /PZ 1 >> endobj 7 0 obj <> stream xUR0{jaIb=)&LEHDqy>J>E7VhopjF,y}owEH(6!pz>0Jh`pktulV"wFS`Bq &TOIc@IH a8]G˹tn:P ̔JZHthW.Jcd{dFՐ Ii u8as۷#<}i'ڃgEye& NلٳUHzcBi#o | d9ecl{=+3X ]â𠹠8}ر*_K DX栥P7E *G/L2+lA\'na\B˴ls" ^~,!^9W8Y6qһV.['gpMd|a°`GV膑Y-gy r@l!֪V'8e̒tYVIrb F8 v=8[U~Am,I~%as[ucz4$]`gUÁNkm&JaAah&M(W endstream endobj 1 0 obj << /Type /Pages /Kids [ 6 0 R ] /Count 1 >> endobj 3 0 obj <> endobj 4 0 obj <> endobj 8 0 obj <> /Length 5413 >> stream x흍8 S%P%P%P%%P%JJ]HHlYdcy3֑g)H:"|_-*atIW 㼖F'Џ)t8OU=*yq@zU<W y=IWɋz\%Г J']%/q@OJ^'*t8OU=*yq@zU<W y=IWɋz\%Г J']%/q@OJ^'*t8OU=*yq@zU<W T{E'У*tO%У*tO%У*tjzT%Г͸zIU=*ɗ%Y $~`^豕@OJzIGW=*-2"-fYܸt<r6e*?fVi_ 0q]Tԝz56q&R8Zef7ŕTu{!4lӔG9QEElX$D VJuKc˚֤{-n ߯QnroKÊAV$:L]ޯt10'fւRLMYwhl-(RTWFbrOUɝ@׏'K@ސH{^Ϟ0g43_Y d,лwй*Jb)C; E r)08y*?*q7a3WOPa=3j(ʽ^3TC\)%uENO(ЋiA5,#?wC׻@ؘ k9ߛSݍV.}=8}L2hUot1 [v 3w90P"2@8b,t0ƶR[IKH8B6Hd4n\H*|Ҧh˹A\{ȃNqz,6pXF'GOa}8Bsksٹt6〾A5}W>{O慊t -*k+t@wsfp"v{exq9w0EG,#B b lcFcd8ndmy0ttV( vF̽OEj6\z}}ɢ?, /urN*#y\qk\ e=a&^{a1r#1=̇  Xpvv>r^^lr :N@>#cڕ}H x^&2#c|Ga9r zk}VjF=v Ճ9vs_ݜJT9E5h)TKKhN6mŹz=l>lnmzth0"5"&Nz^e|+G1_}@8_á-:J>._g t(ۻd9| Dqvڣ惇Εջ~pq-Yp6J>ƹkA$Buk$>|Yښ'W~@YI=3qYjuVZxS"0a$ Sa} aGC ]:$V eq+Ƶ jqAAGAϙ a+;38t8x3>C,1r]zd&*( {qa;8 eqdy׶v߁RXOTCgA \28tƺH ;.AIe&Q>q8΂ya}cA dq.aC GWr9>sADD`  DlSjE.O}0N2ރKcAK]%ô౎ <|eXx]:^]uy.S 5qѲ{;d\9"Bz"ޜMQJ+7.хCĂ q-ڛ]A`n$'wr󾉹O_!VloNYqVƟ!) !kgH rAy ~qVK?*aЅk8aTCRbAk,4\͝ z9ODg>{PqD\F5[G8]ْ_?6?)H2Uƍkv턼:n>tH-[1tY3of}x=raoz'&灠ibBEiYqCm>9^3>ڧg;PyԙLh>芈,:{/מj>tHЮ- 1N%V3A 3p~ U(<n٩6CDim͗CB@b,LrMPawg݉c a+6(`oKaC/AcYβqḢ 5ڗ1KO Кle:u ⼀3]/A7_[zÚAܲ#N3w:~Yߪʲ^A$s&mD;t=;.AHg-h ʁyM@헱6BS:Q8YMnC5Di}tr:t@͐Yٝ z.s|[=@㉼u:e]λ͚Di] :De+a3d{ׂ.s|cs#m  ckQp/͹":G5*-A\Dړά%kV|V_ww#R8}t|kT);>tg_afCc!N_mnT˘7N_OSN $p}Mm VfMo^6@j{K!56PP4`튼SֆOA~ Z3'ЩJA\\m9?:8r雠CWa.EJ+A0s=Xak4^w'>%u7A?APʹ%|"}Tt7Avg}c  lNT[^տo¢ ٴ +Xu1c;[RR0SA4*  nOL/>7AwRo^?V G}m֤ܽqz r&ɩEyŕC. b:Uӊɦ=7bb  tkA.~ϲcYgGylDm;%tzR3-AkA{XNۂ^ce;]c> 򋅊ՠ(!/z\N 꾠2r9] zy'轹{4Weo1klRgAՠ[KIΰQ Aj-[%/dy3([^Y CޣE_}2c['|j6 "Π# 'vbCޣn= zk.=|),z#;)΃{.^cNTrQ!@EY۪DͶ9—vUg)l4Ng۩$hFtPUֈɸ;>@ nۛS׃dtpfgdtd_oQuokl3jо^sJt=!+.k5g!~XF`7k%|tBu%·/h|t|Ly6{ t3?Eh|g͏.\c5 kJt5!͡/m-I ɯca! :VحX gHW':Y*8D/~tXP)6r.*كR#ek S#]Ycu34VGw1G;za6WlM6M *,XK=;n@L'3 ns{ࢃ+by ~](C' fPbRYLa1w5uݜtEzq ?A2ՙ: no_=ۃ zF''fx2Oޤ/Q?:rT鷚U뇷;|:S{ Xn˲gc:&菬Gjc޾LhK^TGA~Ըϐy??2ׂ.GQ1B GA] _Lvy?~]3]4hRvo~o7Ikd&>LїKt_APA')J`}lriUq(1u a8SY.g HSك?3 L`I+vSwm4Wmՠ?= ]t(/Խ*oq% endstream endobj 9 0 obj <> /Length 35 >> stream h1 Om Oi2 endstream endobj 10 0 obj <> stream JFIF,,AdobedPhotoshop 3.08BIMPZ%Gx 720180801< 003140+00008BIM%$揵 خFPb8BIM:# printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTHP Photosmart C4600 seriesprintProofSetupObjcFormat d'preuve proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIM@`CLeveque Les dessous chics pont d'Issy-Les-Moulineaux 01 8 2018_2`@nullboundsObjcRct1Top longLeftlongBtomlong@Rghtlong`slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong@Rghtlong`urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM kȠ  Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?I)$IJI$RI$LI$RI$tIJI$RI$gOJozl\lݎwTI%)$IJI$RI$I%)$I I$JI$I$?E,. 25-JrI$RI8D-AT}7 HILJq05Qho 3BJV)TߴU1sw=G5w6Y]%)$L{*[ U$4{lv=5Ou{kn?7qg6*_dׇVi{vmϩS}@7H;.T\6Wn5v7 3"%ist5iZǺߙ#I$165^n`%XvVRc\%vA湿I}&XZp-kZw ƷP\$4l26ulh;;D4ri:5heC}9@2ߺgV9ZZƂ@Dt}@ڝcIs|NkC1>MX53ՙyPZ Ww{]~qXKL\z6zu^׻껝i-]yaH׎ELc\8:L ,mg1/⚜j!sҹ᭨ݒ9/IH {k{^˜j*c@$յlcj q/?y39\K$5~kTH#k;6of ?P~id1?"m4_XR%s=Mfr[sO*V) A~l&i7\)-alu{=Owq OE#@_<0_~cizLiзrNd:ˬ<.q +NekicpYbX=>s:]kXϠ_\ӆ'wc?wCh=To?k?9k@ CÁ'!+`f}d,mT&:KokcعRnC^mǐߏ5cm,ߡ~63CY,gC`٠?UY^Z{|Vcwٲ= l%Ovnw&w:yW_: $o%EmE*xЉPI>DhbkZ׸ cdOy;~2^ Faߥ}n.>5Z5;'R[5YcUVF3q88ht /Oktr[>ԑU|՟M@62,cn>6oN21*"@s?u=+>l~n4iyI{nl(饏%z ~8kVNN+q^7o{7V&*SvԂ[l,yp=?t8I 9c J;LJ8ds+Khuhp?N1):v염?tde o@W'\=vw'ỿU38O^-Vi HE  kJ+@y&$R-kvih1m0251ߺI '-dKߗ]KͲ;wVvkH`@As?F}Iq%a`0@q6n[bEY5ζd (}Aknt~zVPc׻V˪'k'T[}8NOEoc,oxciŢ4 Ljt#} ]wP1+h5GDNx'D{T4hGܘ"rH1*,l׶;@}۷=n@h.`&Ru~8]9>v?.!@Nw|̝FڋqH0G?rw 1nI!E<&}n4 oT=Wnct>ϹOywY`흿KTO~=_: -<ƪ%7Ot+ I'{?Ue^L{e0zG}7e:sx28GMN͘o"tʅiwQNv!]K<ˣxFuz;nik4Ӵ ަ(9S r o77^Pm{e0&K7oQRڞ y }ڭYe튿ڧ_oOP_+SYs}6uO[G$-eQH7+p%L>c} 5 ;@'+ u;K#?()fF;0ZAznqs ޓ?Y73#򢅝~?ޭ}ƴKiqڑZlUqa~V+>"`(ߟMSQp)TY9%H\}Q)vy\o/o7bJC'<`aB;I78BIM!]Adobe PhotoshopAdobe Photoshop CC 20188BIM.ExifII*`@ #(1$+2Oid% CanonCanon PowerShot G5 X,,Adobe Photoshop CC 2018 (Macintosh)2018:08:16 12:12:54%&.'0202306J^ fn v~ I 1313130100`@0 n 2018:08:01 00:31:402018:08:01 00:31:408 6 2d`"S7Y``"(* ,, Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?I)$IJI$RI$LI$RI$tIJI$RI$gOJozl\lݎwTI%)$IJI$RI$I%)$I I$JI$I$?E,. 25-JrI$RI8D-AT}7 HILJq05Qho 3BJV)TߴU1sw=G5w6Y]%)$L{*[ U$4{lv=5Ou{kn?7qg6*_dׇVi{vmϩS}@7H;.T\6Wn5v7 3"%ist5iZǺߙ#I$165^n`%XvVRc\%vA湿I}&XZp-kZw ƷP\$4l26ulh;;D4ri:5heC}9@2ߺgV9ZZƂ@Dt}@ڝcIs|NkC1>MX53ՙyPZ Ww{]~qXKL\z6zu^׻껝i-]yaH׎ELc\8:L ,mg1/⚜j!sҹ᭨ݒ9/IH {k{^˜j*c@$յlcj q/?y39\K$5~kTH#k;6of ?P~id1?"m4_XR%s=Mfr[sO*V) A~l&i7\)-alu{=Owq OE#@_<0_~cizLiзrNd:ˬ<.q +NekicpYbX=>s:]kXϠ_\ӆ'wc?wCh=To?k?9k@ CÁ'!+`f}d,mT&:KokcعRnC^mǐߏ5cm,ߡ~63CY,gC`٠?UY^Z{|Vcwٲ= l%Ovnw&w:yW_: $o%EmE*xЉPI>DhbkZ׸ cdOy;~2^ Faߥ}n.>5Z5;'R[5YcUVF3q88ht /Oktr[>ԑU|՟M@62,cn>6oN21*"@s?u=+>l~n4iyI{nl(饏%z ~8kVNN+q^7o{7V&*SvԂ[l,yp=?t8I 9c J;LJ8ds+Khuhp?N1):v염?tde o@W'\=vw'ỿU38O^-Vi HE  kJ+@y&$R-kvih1m0251ߺI '-dKߗ]KͲ;wVvkH`@As?F}Iq%a`0@q6n[bEY5ζd (}Aknt~zVPc׻V˪'k'T[}8NOEoc,oxciŢ4 Ljt#} ]wP1+h5GDNx'D{T4hGܘ"rH1*,l׶;@}۷=n@h.`&Ru~8]9>v?.!@Nw|̝FڋqH0G?rw 1nI!E<&}n4 oT=Wnct>ϹOywY`흿KTO~=_: -<ƪ%7Ot+ I'{?Ue^L{e0zG}7e:sx28GMN͘o"tʅiwQNv!]K<ˣxFuz;nik4Ӵ ަ(9S r o77^Pm{e0&K7oQRڞ y }ڭYe튿ڧ_oOP_+SYs}6uO[G$-eQH7+p%L>c} 5 ;@'+ u;K#?()fF;0ZAznqs ޓ?Y73#򢅝~?ޭ}ƴKiqڑZlUqa~V+>"`(ߟMSQp)TY9%H\}Q)vy\o/o7bJC'<`aB;I7ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^ICC_PROFILE 4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաICC_PROFILE աաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ICC_PROFILE ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%ICC_PROFILE $ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqponICC_PROFILE %m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2ICC_PROFILE ;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{lICC_PROFILE \M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ C     C    Y!1A"Qaq2#3BR Cbr$4S%5csDt&6ETeu N!1AQaq"2#3BRbr4$CSD5s%&Ec?|D nM$ !!H(Y@OH(Bh@4B!hRH#(@@@@4 Q!BBP Ѐ9!! a d h  @@$   !Hh@@@B `0!a@? hP      @@4 Tt@@e{BB  >h@2Pdn d0 tBBK@FP6BB: ntB!!!!nBH$h@ 4 !uBBuBB$   BRd    " BD @BB$   K( 0BB!!ЀH@@@@@@@h@@@,!!ЀE$ ( H@"9!ЀXBBBK`|@$ ((@@    % ג0 BKtM!! 9     @@ |@ EtBB  I&H@@P #FPh@,!!Ѐ0BBB<Ѐh@$ u@4O$H@@@@@4  JB!!:!HB!Hy!z!@t)$   6FP_D  H @a514!{ЀH@@R#()@ !% 0TB@@[Ѐ  9: T)B HhrBB!tB@4 6B9 (@@@>@,Bꀀh@$  P]BB:D  h$)<ЀH@4 4 ЀYBBBB~h@ P:!#(@.{uBBBBBGD ae!!aH@@,#B:H4@ 9!&@Ѐ@$ea H@@4 BF)u@ e.hq4M$6O*%@RO*#(@B @@@H@4  e#$S@@ЀH@B@>]Qae @as@$(PO( BIBBBT    H@ KR$  ((@ h)u@BM}@:&H@ BH:@"B!!!Ѐ]H@BF7@<(JX@ !H )SPPA(   s@@@9    hFP0@-h@/@Rd(h 1,ny< P0BrBBI@  5H;'YB!tBBh@$   (@@x DT ~i M!ig(@@   Bu@@# $A&Ie@  |!ЀH@@@@ Ph#ae !#vBeae(@$ B!     D ()BB  !0 ;!ЀX"a9 h J@h@,#D1'niD tBBBB!/D {5\iu@@$ Hi  ϲ d a PagtaBuFPE 9  ag@/09!Ѐ      .h 4  @ BFP ! H%Mh@$ BBBsBBBBBBB rI!#(!#JhMh@$       P (@@@h2DIH ࣒@@$D PH(2 BrBBB9 h@ sI'K*@#  Ia   4  @4 Bh@@$  BBBI@H@BBBh@,ЀH@@@ B!uB BFP@B!!   F(@,G0R $)iFP (@@ߒh@D 9^@.>hG4 !(h$I @ yЀR#䚀$)A ~H\Ѐ9!фH(@$   @ Se]@?4A@ЀH;H< !#9@4 E@j%$B!!a(@$      s@>\ @$e4Tʀ@ r:$@@$ ad&H@4Q$|[ɄB! D r@Ѐ$enG%:! BFPA&H($BB#(  B % M#(   Hl2w@ hPyB   2H@(  !eHGE P r@>h@@$   BBB`BBP0:!rBB@4$H%Ԁɠ7O(2 }PhPh@l  P9%Dea4! r@ FP  @eTMh%I&>@lBP   5 h%R !! %4w@($sFXʐP )a@$ T  BB]PF u@ h@$    H@BB<(B FP .J@&BBBF@>A$#RH~$aH @r@@@ ($@.h}P@$HP6@H(h204D nHR :   H(RI' J@s@(H>hȠ:Bdx@@@@\ЀH@@0(@ ae0=D H@ e!HT99  $ @@@$   K( 4!$ Pn  !!!Ѐ:!BK<Micd 2uGD$TL(4&EH@9!$AߚR$I/T (!I#+,$XIH(89  J# x $~@O( BK @e5: 20HP ϢB!MHM%G$.EsFP0!! D RBB@@@@ Jh"M!!%H#(BB#(ɠ @4cPit4U BB(@.@@@.@ 7RU~e)d 7> xY 0r$ĂhH?9 t/t L  9"a9@&MaY*@r@<@ )K(R6B( $HPx@($ 2@РeHHPa@@@@l &XFP )2 E h @@@ gu 1j! 0R@10P@PFTja$P@@  aeHB$|Фa@((BB!ЀEBBBP;!1B!H)i { sRCnk(8݅KEhTk%]:i"wA'~X亓:\ <-//+lrX)i:-_nnN+ijgz]Ӵ> v?C1uKE4 LzLrS Ɛqy)fPIB#(B#G5,e<@  ec )[) i($P{%$J{ aA@RHTM@ 2G% 9@K@1% B t$ tG(@ s䄇DBФ $@D2BRx@ )()\H4M!!Ѐ:;D  0yI&H@4 5#?D eP2挠 $ P@M#PH@9 4 D H K$XoB=&Fe )n@@@@  u@D #4yFPTIH@rHuB?d4BA@$e(T}J@&J@##a@PR(y0HPIHa@ s@>HR )r@47P YA }P(BFR2@@)( F6@ lP2KMe% Ph@@$   @%%=QHhsGDHvBD M   BeBBB 4 !ЀI)BKԐdдcm  s[ajo&Kc[d2H@ a$Ph, n!!tMЀ  sR фH1ieG2Dw(e.H0Gt1.@ @@P hP)FTFvRʀ$hʐ$e@ l 0HHʀ,#(Hʐ4e@2`@AP#*@#(P27FPB@@   2P@@@  Q @#F6P(@@h@,$JH00  HesBe.E&H@ aHz?t/~,̚ܬN1Y4FLBа$x hBD  ""PH@@Mє)2@ H@QHsPR(!a@ iO; aT掜撐0P9$(@ )()$<2>e5HKt#l _DRrM@ O7@R@@ @5INX@MHR !#nj@& 0;h$uRy@€  2ja}T@@ eH #(2@BeA" @ rBy$i$aЀT)  Ĝ kx.Y" @@"6 _!/; p'&%+,(BC5@&j@(@BMP !e@X@ @ a!Ha@AIߢ r@.e,}x?d h$iH B@@z*y@@@ )06FP  !@eHeA$M@@J@e5O(@!!!#FTe@a!#( @%@ l 0@h@  1P d /% iP!H@@P@BDSP-"S@4  4 h@@'d(@@$t@>ꀀ\ D|oQF7k5͏gtNjJ猴lWGҚHLF1=pVqRyB_N߼8^|\OۯM[oa/^iEMςX9否Qi /SjS3FfXZʬqMO /G gq-cmdΘ[i)0t*H*)Y($K*@a  @Be%i@ɠR sO(%h, #( @uBFtg&0Q(F0P"R*H@B@@Tae@ @B9!< Tr@'(s@@J\: O e@<$r@PeH[#(*@ф@thvR-PO;@y)Fe@GU h@$  T) (@:z(@"QH0H@ @(@ 4B撐G!y H@D{o$ rRwM@  P7BFP@$    3 [3cqv\|!tC-V0Wj}ËAp{ R7NO.\\+<;3FzxM(:g_ Jnf2SA6@Cn49M71TAv: h٪0t4mW[QݴRqۆkz> SR9Otq=c~~'%PCvn;LcxC,V }ԍpI՜ n#|Kcb>xw[֢Mk.!"hϢ,'0U$}) j!!ЀH@@4 B怀xB( YXRA$=4FAX|;A\l`BuA@4P5 h@TG!B#*a):HKR 9 4)P,l2?t hPH>H>jc@ ) #8@JK4O( ЀPFHHʀQ P.J@#4)F7ʀ@t) @,oPB@|ԀI@  FPj$ y@BH P2$bv@9GTy(9)vFP PR H]PO$HM &推hHT@H@  I&X"c@9&P%kde>&F G =n$ǒj@F>sI!HH@.PDG'i)5=4<tG^H( @g` *@ s@$}yB@<#(s<,cʀuK42PH<:rF OxA@PHO CdwF9 P # @eh-Zt]9 Qx|z#jKY x q'NF0v9zfGOd$)F@!a} 4  E>R 4 !!a% PK8B P$ @2vBC r@eHi!F2!J`($D#M$FPFS@ 3Fr2OKT auM#8H02U#H D{ eH 'K(% xL菪9'Y@)I5(€BPR:D t=yl: y@KBLl@ Ty 9#BB e<접a% =9%ӚQ $IRB* $tRy@9sR@@쌠BBFTh.jH!"h$ |Hctd I$E@I&2 /u iB4(P 9 2D!B r椁熢Y AxONՓT`0Y$1$  BDv((@#(e0$wR<(03H e4P0a4R@4c(9 >P@tM@H莈9&@@B@< 0YB {O(@@2@& @ʒeA"Ϣ29n #(Ha=[ $9&AP% 0 H Gw@G>T2 h<D u@H:#@ь 2=a䠑 ԁ!, !rO*BR(uB6BE@4! 4]P@@"a!&Ih@H@KhP yB4hTe#1Y@@5v[Hlͬ'qS^؆ VEˑSH#;l~nUg9HrR7?E^t94y)̕28bdW0}֒y,ǺlP#;(ǺYʐ<&9Pۚ3$c 9@#9 :&N@RH%9Y #nB  7@Kp0Ԁ )S@$e@ #!H ?4SR% e@M%"PB#@@)z(@R|~R)( @!  wK@Ya (?d2 h,d@D!Fp@ a  B4!"F@'$H ; sR@$!a<AR@\А #%  0!F<B$]Qu@>HAhwA(R $sR6F$$0H€R@BDP RH@ ; i!h!@) a/T$@BA};aa @4 z4}r_ 쎼АB 3GT :!A!eHg(lgTea@\ЄT<$$#(JGBגH䄉BH IBP"A #ea t 2BFP\Ё i!d-7lܞ71{paU| ~n4 &CVY;V2TJaA neK)6mQ#bEN>&FHZ9, @@4 DHcj@F୊/f0U#˪JCEJ ,KH$pN|/p3N/{^R\T|Zޟ$ߩ}8YUߚVDKH+%9ݐCSuOH;kmO>ϯMs=Y%2SHn#ov3mN;ץOҨkiDo:@lcs9+- v#ZhB@ e  Mh@B!t*@=F@ e)cerj@(@$XL j@5 H3HB@>h@@Ѐ@ d   4s@4  h@aH:恺$Gt! B20 !!#a<nH@a0I#8@@@F4P0Q$YBH BC uBϚ#dfM8Zԃ%>$2cyY5J%,mYYG KnX0A  #*@.L zVm#Ĩ/|]{\&8 ZNtg' ?WÔ6gU̔.(I1N6cm_ueN;GynU++ϓ|K=v?dկw(x~MdfD麡{Eꪪ_< ! >\5m?DVjR~Ԟw༾y={}ڍBRIQkm~?|cU[Uж/t ru%)d#B.I7)pn0REҩ~kh+Yp T(TBM~i #tM$P@R!2$1TM@9 @>|(!}@.HP!RHsB$)H41@, KxPH>HvF;B@%DsBCh@}JHH'd!  7@4h ! P BHa@ ]PϚHtO8BE@! dr@ 6B4] "6d/cY$n;!a$ @KFzg*p jhH@gd$02PFPXj eBnZNʘ7@q-粌,cJ-;-l5F[P, a,\!H괽Υ?98ҡH&?5f8MRI1TwdKϪGd'Nejʾ kc↰1Gn{HO{TѡʤGk;(R~]WzOlO÷[d8[x3;CL~]]=3@b\T!bORUId)BDSdB.H@@  HB>yP@줁G Ѐ>H%:!@PHG*@7@@>HB$P 0T26Hn$АK(w@@4@P ! !r$B0@ t@ .H` M 'doJBD} xH 2S@ !#@4 20L!P#tK(9!!'*P핶)d`jqYi**g,D\дZnul=fӔ[o^,\/Ô횾..{\viv%Q=:Is24gNs/C^ڭFSiJRMK=W;MzVIܲz9 Ɍ Q0~uH𽏪ş,G* `Qd$H@$ ae)XIЄb`#!j|Vb/Xܓm߁6g`lL>KMNf 9-fFBE BC@Ѐ8R,sBmvV8ȩ@`$<dB׫ ,e-9iXH((pP@&Ayl(@Ym0 1|V03YjV8'"5) & $a djpsbfYl$`ce1y !R;N쪍ΟQ[\XW~.l+ $ g(H0P R(9&D@g4Du@$H :OR4ThH^@ct! h$$_]4P>h;%@*@BА9=H@,(H4 r6HH@&PTP:"PhPI$yEFsd:FpbFP D$HBBA@%ќ)$/5 ɼi+lvf, !' 7) [HZGPy/wI(),?{]٧Ҍf(KZ| ѡMn/k4t;9]{#}=f5;͂/q8yW 8[8b])cqw KRk:n#9Aehl/WYRGѿn=vi/+-T6 IKw[fa=9u_#b.(|s]u!r<՜gm7 YbIN@4! vBZ2㪒XIgf2 uYi-#~أ(V4<;;b4p.k"*bO1Z\+TLUHjĒj<=b4 T3 fZ%fdz)L4sZZɵ23\y-RF0$ & "@Ɯ9c4z#V7<`2m7YӼVTi5I@!' H$r@,eTB20e@6FP $4DK}y I{${$Y)l{}Ё$I 27P;%$( ~@Bh,R$H@sL$(@Є^h>@uKBA@BA@!!!#?tH!!GD$h4 P-88ؖLL5r洙y$eG-tPPmde`(caphߚ$p:DNK%PAZ嗺?g<# B.RxH8 h%5 tm)[$GA|lGV+[΃Ze FSU!VW5.8\uuiܛ%uJ=qc8sH JZvUY)Gr@ҧQhХ*M^ ]IVsU|Q>iwF\Z3"Y欠MA;UkmM,=6+kjHTZd7!fnF$t-ͨSYdJY wv22ٚFN}~Sff< 0#+`XbEXM!$|PK@<2n7%m1f\Ӹ94 d}Wҵ Vz|CRlg[߳N?voŖ#|5Pʚy{NA[c17VظvW_VS5A@CH8e}]ݵ*4ci%3TX*)IM>/7d}pIL}X}D:Ic׭ch6|v.xRHA$8ͤT^ EV Id9R5<Ԑ'`zYX\'c O$>L-6n$t^( i"IJ+1&@t<$9s\1PVJ4|<=k!)UF5vߌkࣵ:Wcs~W JZ?\&~K> oCiV} _t=&Bjy.)kq%˟[)("4 yK[9GOv/#zVNr|)/~mt5SsQS{G~]z\/nGy&S[(5J@I!1^o"aWS>Fy/p0N9y)q#``oǒJ f#9'S>[yr,J3~BʅkjN:yi'XK |Rۉɵ-?"R,/k_&\eg `(CGn1 fm;HㆰzneZ{7u3yBrW=ckg|aĜ;4{ dUƱv6#>jVP1>Ehtخ6`7D)GUlB|2 ssR6X[cklG\VOTvk28תR!q,58h>Uu1,4pIh=2}|FOoLu6?~YF5X׎w?H+,gW4MPmpy/G7$2úd4| z(y[gU=Z$k~ok$Ba Et@ɨ-1$ 2,!= $H!B#$B0R@L! p@  N8RFFxY6Is2i?D2#?P q|A͎DF麘'96ExqXql6x.˯qǯػ~%~ut.VEG XOﻱQ 'ss2:)s#QoAK>*8?Aq)ɯ$"6ZTK9J}˔4O<~1TYt`!yZ{Gկ sn?~M g?hx_jc#Ӕ%){cK(jFCVC `Pzu_f |^+qS4Z60w5#+OGueZv,}oj~F3-e {jN9U:I.1NE\ y0lY ͤK:7TS5;:U.![w[wU-9#ٱ^諚㪞Q#q q5kRP^.yu7('Sw8yfJ1$~`/uu)Ң>Ilˡk?QC7[!US cq$ n2rm|OQ^+( Y!Ykʌ`g"cw%TRE~{Ir>y+пM|=]O7R&^|W_ARPGX)AQLXӹkK^AU-)!dQvTI\ׄNj2G灏K%XGw@փ1:-(#N!'9ea=02 __eKslh1 F@9+tVMr&QNԯ#?q׆imдVx =<'::/ :Pu9?,z6N8WUW)ml<_/qvWؗacxS9%tRRAZr!$cþF4憙q`8G/8U(,,]Ua/ !ࠋn8`e@WkK/,=.;&_DK*@,H’]=b?;TV j>M2&P}VY!,P1!d\vQ#@rV,]TH r# ` abF}D ))`A$hs򌕱/[7S%ҿVO!_DV&.?T WA'0G%U}qPYA]KsMOhs,ʟ5ۆkuc^.qG3Y郟I8Ρ;vʄ_ ϖ'Z.){YoK:_?f >i\I#CN|$ Yis$;ƣݪﺎSs~;'>oM%5)q*屖&B9e=NtQEF= JIsǹxH(@tB%}V\,J1NFP Gz wn?~w ,%!;?)~(}ӏN2w%'Pw.8$21D G?p%5@a,#eYC-Q\2oci:I?-oQ0ƽl:Ϋ^Ss+b(YJ~Ҷޯ}qg3Qr$Įt4M?̬p8~ڣ߼[VR<B}JolVEPᚡ\8c餒4d0`J VRSw9W=pnJEśiYuT ?r@sѫ 6邻6R_ ԧp+54pRb }7ThƤT鼦TM=AVɜ:Q[z#L6e6l|A <Qab:" p^J∐G_YU_#j:dRYBeݶ#^Gu칋6׷[Do?-FTo8xZ7ݛwmjm9GUQüY8W:E``cdn<[㊤4:9D<\V[T{ŦvkqOL~-:]K)n>djk">8<Gsi?rmzb5W%8j5j3.ǑKzsLv֓ὣRWjjF;zp)X渖PZew-.j7})jkxt$}iy[f;n܎9/vX貦'5e;c|5848v^twΓ!\Z{/O|͆!k>E·TZ2kJjiIml= +eTlA'6 6oT4k"eF: y3 @`>>]TG8&`79JE3KH' Va6RJ2L Cui6 CANƷS ЁwZջvx:Qg’n5K[SUT twXr~-#zŤ ȯvR*4fOo?&qcK-V"oNÙW6 ~ǛyZۑUHO>cCG&."KnEWJCO-nSy$NV~#B!uB(@@5B2\pF=VIxٓ8,\cQ+Ֆ~I:58 *\Sê(㙵K$y!Ӓys\%3Qd"A,p1e8aNk-<@ܬv9Rֵl[5t`Rx5Z( qkSuylN} {:rA)Erֻq kv1ӪђW-8~-GUrDCߒAXsZ0UZ͢z/T9q%YFC,2Ilh%Plk-ks|' (7P2&mC)?R@۞y‰Q -?=VKs˸O|!dױuv{|]$Ri~gv.u%prZȷVEO!UQ);#S~f#0 I18FP'#Q# @d> N\*\r_1 GѹVQ2VRrqЕlllXft Ӄ%;c}^&e2B4M/,"|:)eC@Ơc`rT*Mt1XKuL<>ICrKG{mH]isiBjBIsNh6O)IJ+$;ư`X9@4͑\3y|T7KWt0F\2G/Ge6 M<Tey J c8M5ż%pp7*I~>kQ>i:?SCrS$'#Z*O8=Nvꌸvg/!Gj=`x7xJ+z67a4\J[2ޕ|gb6 9eNzetD)94oBC!J=Q#@̠9! @#tIʕ1U\jڔMXd9{vN`0̻ȺlQc擡lcV:%<1cT4?V3)- >wJy2fȦGvQt%DOn0ޙ>eirl\Y,I1@P<섋 0K9D3&n5 kh7]+jsQluJ3%-W$P2Ǚ_kR6%\V]'yV[DŴn8o>Gg>^8oYlTH~c`'/=ةtpUƫT*#&^lmƅ)T3kx:Uv0:[>I->*|3k~AF9 UvsN>6mnysCRd MAwei26)D$|n-G0RصaciUqF朡pީk)*#+s7˕ݮ#ڽF0$/Egzz?NGߴ>G*x)' O$oe{@蕙H]R}6K(CrW a dҝVq3)`ФE#aCggӎwF:J+ў*FwwMnp۷-M~D@pߞrw 7~mh?EĹVySG4].F N>gת%jRr]MLcK)0C֪)/(>fcp+y >y UW hNZ\G} Oq 5-A3\{Z]? ^R@YM5hQ*ECj Ѵ` m; K+gc *n FeՔ-ҡr8z쒝+ /?F1~knl<<9^~ee5ު|[燋+(x&”}Y)of5c"1Kqq{v%.cp,ϒݥzoڋ?jhohBn#ŎMOʾ% բwex6/ѩp{dc\V{ԖQʽ7Y* 1 &b8<-x]9$\G`4UqS rQ+X4 qV(4)Iexx+Bu) i?:S ƖyWRSHl֊:i g{Zps[TJ5›xyTFώI$Ǚ]OqVQmg.sN[KHh Nvc[#8gSci9\Ζ_Mn=ӹdy}UӼסSJApT$xk;.m|Ow_xMSCGE=ak{ظ4㰎U4wquR0@0p3t#r^X)#s5)<;<$3PӮYi6M?iRs~;>0RUT55ط}7 ۭ͍q'ÇT5ķpC5yN[yLvS8vyl7fđ#O*#(h( #-VDRKZFeoe]&%bc{6d佞-FPo}LS{=UvUhf 02OgW۽7 sʍsZHss^R쭥 I]P7u+nx:?9qŬ6-w'-Æz{/Sˮ6o# 4r_Ѷ㦥|%Z/vrJaے˨?d! 8* ,m1Gu(X2A@up%8a<֒mυJ}H3i Z5xӸrXČ'8|;uaU’0v R055BPI~$I ]V[ĀY7n^E\M'P$EK.[0.k;E21eԕF"@CNLitgo g&f<(Y xg(BE(J0y?4FD)xBePΝ꺫=[j;d25&?ˆ\Ro=y|NmKimoRC##Nٝ{qpv6AmUy5 M~U:Yf6x;NTJn9qo[l}Oôj9,ՙVCd@$sH呿E4s2vM5ҝN8kK;c^jPGWEmQC_E%u+t+}:o$^п=h1q.%i-RSݷ]1t:h {g[掿8?q><[ms,RY6n QwG=;=4"Zz8Z25>K dX)Ԅ 'ȧa0`^< dOaL 'ba1Pi+ZÍ%oT1ɽ9 po,28 LW~_C8џGǏ|!bZGwT!:X2roq2t#ş<`yZ%ZGYÞ4s.;TM=?S9PR6eaO#O51Mo<4zRTY&S5Ԟ3?UN/4cǎH[_q8r"胠s {N%/4?ujfL{523B;Xi掕-;PeNo28)ZML81B߸ÿ50 }MKN^;;9Ӷ}ߵ͡W gh8`>sjJk ruHָ?oQ?3>.tM\wvGYNZƧv$[-?,zscѤ*4Iyou4o[Kw7w)7¼lA?:}@ab]&#Z"%𓝲0־edbl.9o X?Rw𬗼 ZtDVrj- U2ɉfVauXd4BODjAh r@x 0NCAYLi>K> ;왙pۏwu2A?O#~x%2QUfBI!l cy,Y9,]9$bi)t#_)[S#%#SAryX@dk>*{4?Z91rG|%Ed_`( d=ϘX~qR_G7?g#prN>#aG͟ꧺc8_b+C҇Lf mO~L,?ǷFaOwOq3!OOz) dTSW=qE C2Mut~tXv:o(6*|;v>-՞Ks2 |y:c-+{իzHNꊯJTUvʯfLnۖ^Mv^$Բ546;/ZRv=F+I԰i?;Z;u}o e=ll1i3FtoFn*vFZ/_N[&&1||YWŗ> T6{|y[`{bݚG>kxvg2<\ [fF'cCRD!臖y(qnw22k\NQ4xc۫?BZ:~dc%f}Y3;&邵n` a96FH1KANyQWXe|ǩ 8 $;I6Y {/l;q5C8*? A6{@OqjU?tIVdj|в#XG,.;Nȣ@_Sݥ%^&qT矂5V\s>88|SNF8OVm9Zhde@@(5l+P5P# OD?pKĎ$lYwRH>OY سcȞ$bi$5a2dӸs*<. jf-hk+hcKr]UIˉ,%]كYK;asXqXO9(F1֗8 !pg~]zTx&Y<~{iEIE|9Ǚ MluQ{js#!EKV"tx^;-hKgcKq|^[iڨYozA|H8e5](`IJc00^ʺJ <^{/Ϳ>Gȫ4{;\p)-7g?ɬWi8`'OM^yGy+l4Դњk<~!>q߅ԯoL%+[ ~.8̚]?LJ8/vxMwjs)N=#~+Hbqӆr4 \`hQ܍ jZYdhh^Q$7CC+siS|Z_7,vmM5=3q/}+RC2I+ .G,{Bk-#8}>Z~{CYqVP~~8x>:;}s#0\s-qݝ;YY]Yeҥl?C Xw,xvvjآnv5U%?fW;V7~\Z*omkN)}^d'i65q+-2HrgyʞOW9Z'g'} ē/V\_g7*ku w79q?@WfއM>I<>5m"i,g=Kꋇ.IɟÖ-l1iĕkzgerFD0rVˑi#cimS%ylpQl`tmTi,Ӆ9X2L9,YrK[lH&e1fȃc=_dsc \sgk''Mʛ2u t^}7 ^&bu3m$?A2ٗh,a* ?+òڼ)'WV}^_ o+*O;9g (uQ3Pdά3ӒiSlGZRGJNg~GT{4c}U#culT9>C@ay7ckI± X$ 5% u 4x+<dz -Ov/5F,` PkY&QL8yQ60G>K)6F*) sῦ 9rFNq\هu#q>`G,R\b R7@?nϺt񯙐Tg/-n}[g&:3Ӈx}OY}=BsFbPpw*}Y}\|ѩvf,sg@xX;L}{V2_3֔F_2)6̑Q q7Vϱ|_arSh?G4}?ξ+U*R~c6A"e1|M$,cY6Prf?}ͷ9;q) o-ynUITM`v2~5pN):##JsuR?NFދ9F9܎7r5F~g{.&ckdNC fc ~jFok!Lm.9o^\Q67͚ĭV_ y"x~CG򅈢Yp;|TOcJ akiciÐ7+6yỾe݇  YnLk.? )c?;d̆0ѩ0"瞤`)Yaq<ͦ0$abԉtx>0y%??Nz_đHhyH2AHSDcӅ>р NNPFvoxX;g _EK3~Jx$2>/; pXy~J{21NK)CKswrCg nŴ {FG[yi%OvFF >xZn3El0ɷ|Ϣƽ=Td E"*p57QZe?pk\khkƗ쳃̢:r5-$2[=Hly7Z$69OBAS'% p0^ˉha $#[2HR1ƻalI;,$n[H8m2 2d9eRrg%H- ܰ3;’ HevLn2 R4>mH2^Qe&}D1G(#$rZZ6r`aϲ Ȍu bL@Ӳ]Y:S%Œg.gGK3g[.@ X'E+~1jӺ sʽ y3S{K$kGY*O!ato.C&1h\^9^s¯ jԼ\?+m45s2S9c<#=7P$yMq-c6Y~q+҅xTS1|ǩ )lTm#d$=lv)=4iJ2*6wx[)4ygUϲ⺑:ݴG?U`JYfFUqI447>n}6U(+2}/Z5I~rkv¾'s5N| O:Ƶ^G2(Z7]E ҝ:^~ş9rSJ)GRK;Ŷ{Zl_;Or0uhg#Ego3 9 4HY'ϳvXխFwr_gmuMQu^BN0Oz^j'z{e+M {peEXqq1Ӵ3$dO#4046 iynכGUKlGFJ>?R׳'.-?\K$Asbik@h'bq0`GFy %286}sq79=g]U@=8;SqrشNߵG1s,SESo;[''ٞߊễܲ(W(W:)}$0 |:sBq&6z:]4ۈTM)-ߧRcچ^[|x>V/[z ''xF;uzsogFoU8/j]/Et7-g>kʩC\8}7t NbuK``inV? uRZRnu9(wtjY}¸(\\'|+>\ڒ-~&!֧e?kOU{5"r;Oͳ*JP(1w-T ,|o?b%貾3g%_+nɤJzVhE,9e::GKU΃wF=W|c;o42?'ɚ8%вQtH56L1UUճ+W1Ow̅4`~oN #w$=Z>8bFX1?Uoh)<Y/'|SxD?1`8#7JPf1qo3` >Q9̲lH&qk41|!TfCwUe [|]Xc>ϑ吏f?guX |`|c?*|k2'zߏQyG/yg N&"PneC}2l^fQi$mqZ.Q[I@v|i=.{A=W nIZ8zm'Bcr[=A>ák="Ҫ+Фz~? ԇ+r>@ _5H-,nLPw:P10D?}I0_ACu0S3j[%c.;,C=J1y\QR~Wf0 RcIq6<.&XKuf@>˩X3<'Y*2Dz/e{`Nj=>2'L_ lvFTSoV;U0r1nwYG|#V:Dm_= Mf !mu߁=15f(?hu?8X?2m}-&?u=#YG|hIN9 !A?3N)äGqQAP"v12KߒbqH\_ u'y/0S~#aGsN^# X^#$F!3/!~>~^?(Q/x|d~?h1" F<ޟF(~$r.cwӝ-d #-w5CwZr|F$8-~Vr 9 5L9F[ȭ0oatgIQ$=?+12ho&DZ1''HÍ1>yR6A:{-Z%٤s[Y4miYZ7ɬ#-~c;KmK ͓>qgFZ%3%&䍮#^Zy8kgl5;ٹ9cNVtr벡V;b znU|rE, y!" l!U\̷SOS.,/~\pvrv68fυ6KEk–GS+axcu82HüC۩.TVD&DyjcsOV|nʭ 2qyXsFS.;B٧XƂȈ##4g#k5h&rn3q$-MFN19[0m2|ķlbdac UeK SYӃe$Y$M-%pigm.eд8ӱH>*Զ[zhhi5h/To =Ÿ:./-M–w9uOn `92xexjH'uʶu' }7]^Fғ4[Ge88f%\zF9/ wq9$rW긮Q6FZ<2تVl:U6hեvͤ/N|1+8=qEχ/ԏ^mH9ZH> reCl#ߞgr N& {8?uU[R?L|2Ӄ[T,jo,mmǁ5g*m;c|mBlL'8Virx5j+,MFex+>ai;7̯UB4R(/R~伣η3W5d|%Q>CFkehѵ̥^r}s'Mc?em߈f;tdhۓLZIWAi(ϒKN|Uaq^Uj,gkc=6˂K/RqKsB>HiHΜ=p1"e41TxZ]l3^Kn/^kf|۵䜺(}3z/spfS)F N?i2ɶ vU7cI#5?W\O^ҏd4x}quDHF.uw":g1S6*H `iO2㻉>5$.|f?)qvn6[-xM73NNy GΛKqUطfj{k2i=TMD$2K 82:{ĭ٨[ZVyxgtI.crT<>g 1 ksuTIo7Ā0 =QGG 6 (ĕxe=I?x7RWEK\՞+,Ko3#ɫnq;SyXl2 }1Xތ`q̝̟,nc!'/h+ǂ$'ml-*V=HkYإ6[7IEw.s36_!,e} |?#q5Jo*=_a=iGn8C~-oSM`Vqɝ~j+%R?1#<,UYciv>Jw^wR7:\KO=BڮǏ_=΀ܧggy?k)φ0kϩIw%e1KAk1Bc&N dc8eKG#ܚӂ KnuqVMTհeL @@ qKdI{[%6H3G=^_$N{3sy26rZ-Z46qVUҊXHki W)Kd[Kb(bّYxg R3yBÖ㢰T838XCtl:^&=¦RL4NnypUZ}W\+Oڏmt'*TT[pmlrt=ߝ5Emԕ =X'ܴv0z*ÞdOUv% W\ֺNlg1^o˯7mksJ㗼#X]QN.֞`d]8A[ůjRr?_v5Z˻Fl׮>㰣쭕ZdK|&Io@ ;7꼍x~X>MҔ?jrˍT`l\sĄ 9,),*SM4z&a8 M5<83,#])3Zԥ'ƖeQ;$h*K#'6-ܤх(Sm)2;| t 2~McJCfk &y>&k*1F>(?! x3T~ѣٿ[*kN%ANr#$ж Q/#c ?ĭD-q_¾T*?|1lmnAdnCVs?q"kN.Q-h5EyǎB~8 {*YvIaIgdbsnʅ$< 6Drr^$<l` g%:?L2f&Mˢs`m>JQ[1)KB2101,[BD\Sk존0KexA `u?.Q6d\p}.|( Պ0[N!SNw Y0q*¶eMoLĮ-`#f~#|ojm9bvϣ4~ҔxO98#4]P1C(x-sO4a#g[x} li#ff֗f8S4?VJ)|_g;_&e(VkN|Kh}yr$9vpNmS?|e6\}1wˆکPYD~dt]IeE9I~M 7@1C:5%K JXpᙢ'7G[I~e);)_իZ |?}Ҙŭ-5ԦQQu?KQ-mn5:0|gK ,>^JcQ{{?Ea䪿_/c)O @FB>A?苳w?i>.T/v{ۧDG0Jt[Wfo9ЮL&}zF{M ^!OGw/p>FD9qz>o5ɦݲg #I&=8EG?s̎Bۓ!WSAATWԯ"Hi_o2xb[_݅7r3 Væ^ݬpdS7w=P_邧u?ܿ&3Yihݳp6fw#yoVi%W.t4>h훆HY 'lՃP~=./,e9C,2ԮnXm]>}_ NLkZe}$ͯI.I| {exN gT2J|u `LR=/?h"I_;IGȌ3~4}*\N+떒/Ⱥ;/>}ݐm.X3=~TNxX2!A?d?oL4ljO#.N*Ɨ͔)^=M1> ;e ?lZgg>%n? /h|o'4SSg+/սRM|__Y 'aaǓݷY#ȬWvmso{.Qq}HrEG{6 mB'K%mN*G;bk oq/^iK=~֤s^\2IzŻO/2gC-8ci|e9[ :B m-MꗯCe~vTO9[9cUm!LGͩ':=p/ì;YNmN۬Z|\C>h{{B[۽(_ݯ4&:6K4(jNvkӏWGI[Ydo7<dB|ґ~g o9o gW?H_d>>R5P}U?iw?OKƟ7=UOԑcY?(FvcX=RF?m)qR'ei4>j7MoӄGd\= K?, ?6\ |Q.gÑkt`P- 23/8g][72C&y8- ilk^jfr*SdvC*2m49WpUJtlSIG<5"0kP1a;aGY)j;8dlWJKe*9u]rZi6kfMgk+;?qrR_"3PIS4NӃUѶf W!ųvgE\3 q nVmꊞyD&Zmb105'$xn-m5N0Svx yg~a^_Q5$?éԡ%\/fOvo JJ%I.rW-D̒/SjU5;PaO˯^e+$Gn-.k_'Lw; 쩠2ib`gϩWWZ1U'5ſ3헎/xoUR7nD53Y)"G~зrKKrXhu._Sr<+j@u4}rVc4=K@Z6E QOr.}UMlc?E<|?klaD;r# ?♙~HYQ7QRk]K_Sd̒|[7l7 >zN}4vxrG* ƜpDzzVԭ'C}?i('j.u"$ა;gƫc-w;cQS4VԩbiFF@;yI;N$m w \EKڕ9 GNLmgn=sc<9٭Zչkmd:i/g^mp?eѪӈi iխ7ָ CKOO@S)ENbʞ[i}_ s_ NÕ%,pAœ?AnASh:1Cjui9VڑAn\LqU=?y+h+FiIS/e5ׅa7Iyj(gTkLj)6y585ہK,NI> \ 底NrjKקuޱG@BĪ7s5p}_U0$HuWh9o7tiqPL*SyKS43ϙ쾓j.qm:E>OX-O*=[/N#MgtYâste.>97 tڎvDN 'ҫ/v &sju>KܿIiXf~gҭ~ ?_g\3k+*y:;EA2l0[ro/9;uj~O,ŵ/ỵ볮$+t3Ϻ ^S*r~.ݴ&gb=_:iz?ͩW=9~).تѷԱ N/of5r͟郳x+Kҟ΂?{Qܸ.T=0$C[J]?.+]75>>gOcXHt%WtF5?J_^F]?[I:|U|~i|#\W?1WKOI_'` AU!8/8m-TaERzM9ݧ^KիiQqïYvAV Oev鄏۷Z_-Koo>{*,9ռ8;l3a75>ťWJlW%R^cggxQf+;ܘ,/e>H> ւp'a$~14CuzvC?6HUۚB?i~SƕD#r5qyGj2?/۸yWh2GPA?ޟW3Gr%vO~>DƏq,̷aGh߬=zB?n+2;!/MffjӢ?#)GS>QK.;)v!ftZv\B>JŜ͚hgb4ܻO];4deΖC:P=\Th|Gij5c]N_8[&U?p!1?iǽʪYPt9)q~e f;-,`zn4f'ٛy,NG9~dcẠOFQmL?򅚹M|cڋۜAm0zR7)Pne8w=om|a@j<,VY$!$һt5FgG/(no38#{݂6[9GL(Qv^ KpAGL5K+g<Ta^{F1┽ߖ[VSl7~j{tvI7~;jl|n| 1i8TYkVP|Z8|r%V<-KKqn-rkgMZEei}oX~"OKJj(q<+_IS8e; %`ôVJzBך 8N#&]S~??VW>&%a6F5ӻ~@zxg3cz9YK#q{I9$>bk'{}7t֊v4F ޣi.RLV&wNFR[Qj$].mg@?N>GxK *YQ='; *YIZV߄}V:̖Z/|aKPL㴼ԾS2lh&돡YKd*;^׀\ *>i7ROqBem8n2SIQ$RFq-lZrZ399gc<|@$#`c0IR\sHݦt-tڕcK̷Xe^q/$n}[g\C=Ednz-SթO*bi"7c_Qȱ΂DWvT)`KiZm`w,6=@mۧ&j+t'9oUZGÆK/xksGQ n)G>ۜTp녦yˮzquJWWqnQ,D=7؀cAدT ۙW*ϋd}ڵ'|!<2j8OLanme;݆o%*Re^N}ښ'UEd|.Np~EMm6K274w/ϺfFZ*F7>T_[vwSԟVtӯ(C/Z!2 g\)rH 5>Yew\C1=% S\Ki~PZSK- -gvTMzxxVH8oV64˪vUQ)y{3W5*oXC/1_mTS66 } e=Vx'PAVjduy~X*ķg l7$H+iU_ >~psY<ʮΜuKjڦcLas?Z+.5wTT2'T?c ރ%zV*Rj)v}7<^ :}Wn)/VKzd<\HijC44uϢw򽬚7.^Rpx~DW~h'W4q4텙p pV|k׳jtzTIA3 8bH)䥨\$-#nƘcqqkh.<F׍~6THZN ˂]MjMD 9^vV+_.k%MS#EhmѦCZ]o%> dm`~۩hmK ?5~ ZU5OqLH 'rxEMLK;ePg2@ [UNGꚂ{eeZL91q* VMbt~qcN5U챷睱qyVzq'c,{Dg4-ole=9S[R|3WֵG$5^[}[ZggfgVu(kh/GQڇ;  _5<rтd>ߢΖFӶMC{Ƹs+k ?SȺU;wy%տ>N<blv{ Ńr>vOGy+Jla/Oumgo+s_qY?i_ g(ڷ*^k[J0z+M5Kꏀ=ڮ}UÆq$lEìnv;Tzdzڭy)EIw 8ݩZ>RwaV`{2׸8?{uY(+[(WU|zkۻp즺KvQ#~O^POmB" TiųK{J/yU5,[, :9P chAt+uwJ||x{gNꟃ\pu`&]CLqy lU*U맡CKEURUXkkXx?]J`G*ќ؃#ČpWMElcD+݆&e'oTR:ndo;tNOሣuIpթUU\K/=Es_m7ivw$rG%&K_WRՆ{y.ou>;n"G=, `36gC1nWf6E}xxx<#-SCWg^4]~$!{x5,:)psdp#nC)IO<1rj/=ņqQo>}b\]!W6!֥j5SMK>hiV'ڽbaB>`&x#6r=2 2~it?aG>Сv6ɭ\"~بwͷ[)a{.ET [][KڬMJ1[sP^ddoFP O>\~X]ZF-%D͈6[f!;'lz/F]mgcZeE-C\*OW6yM5Z{4z74kJ<3OgUWUjcv2>iG<}WtCPh$O•#94<=m%RF^WW #ۗ<42V]{qlW `\ILTa$%%XC_NoeڛK‚H&qK#@*:4#MUʱAN4)d7ܮ f0g_8<[lUU'H}Vn8lkkq.Njufbct1SϜ<.fbuNҊ%ɝ~~*uw%x4'T-1s)E<~8;zmV.W%E4x⏚8]-.!J gs{qz KWI2U@֖ 7*FZykUKHq{3mXnBsU"3[ͥY$y~ZrUlT` Ⱥۧé&c&:쳃,{$ . 9EbۊEY_O5եykVǽJSMtog̼_-π9FA['{)ZK~w/OZ뤼^Y_~TSV3=Ol]RA +nI aqs5d]v$.pXHݾog{^pz:k9*߇Y[L2O>j䟂RYٟ6Of ;;;e` '<{ٵDž.qiؿ-ſ5P2r14YF7t!O8|J{Λ.(89)GK27ϭ6q>q'kh:T$ >?*;#Q<;-F+RW q|$:4I뻍#PsE|1?[x4*z3 CyCyG BSF̪,ά\Zx2ur+_JDcQ+Ըɺ8>dpK(٧ hƩFĤ]NOR#dvfGڋjo2Y:gcĿP#<#Tw-4:1xGp`KǕ5 sT+Zxf=mL%5s$K=6Jy-IEo)IbmI;%5B9J[$ϯ"Κke|5|JE 0{|9+۴6מ6 OxY-8\ӯxQ9</}Զ3}W8xӞնo8xncs#K~|yo28v|F?[YMc?XrJφ4i '/wQ~]O%]W4 )My~-(;{ka9q %9.?ը{-׷7Y.긿ap6S⣞c?Z.׊>f su-z.Q .+}g7Wj^۬~'{TU]./Y+”rO[_OI c.| TPt ծSsE?Ǘw:QBM[u|2~߯i+w裘/#lmZ<:!Jָ]i/y./I{X#{Rd<-iϮd'Tk$*u\>hϳp.ү* 87TPJv= ^6mj7N<oP9GvJJSMS?r~>Tf{u*;wpO,/"jߗ#OCLʊKS@n2%áQoq6i4TGc\Ep\ќdg>UdlTGH6aq,=2N=\"s6nϺm[FoisJYody~~jk:}K;:ṞX++%ƵVk;QU4#|춎=b 'dxN#R7>gg,hݵPm:D*sӳW9SDOV{Ì(Rה;җ%g{SL"* 0[]& d1?/gm~\7@`o=pISqsV>h2FuS#m8k |/_ULi`x29r x5G{*8A\\0z+VjjKO-wF9)x,c<:]V_(gpͯ#h!WuZTp5pH'-1?{֑ѾQ8BE1P r5*_x_|zǪIwHZ*N=vJ.5YSU6Yl ZJB~{2wu`C@Aښ /tYJcc+9j:5xǃ-//G~zia7 ||Qз{Z^l~(xF6{sCY0yǞH4p >\N_&UWksG`k2BVė VQ: RͽXJ=*EҖ_hz'O=H9Ot.$}ĽÈ'tbuJ?k9RJXtR]n'QvSt9VンpQZhp1h?|-C֣eƨT^OJ 8W?bC{m[8> dTɩ i ggW1W4b>,ﯥH V'sGOiʲQTs|sGЫk)W,RagZM-KGj6j>ˮXdg jhe/;a>P6;Cx%dbCCjs9;'F5%JQtJ)/i=zekFi-9NVZ${|GMG~*ڸo{%0IZ PZIW0wjfЂNcߢgm~BXyYџ*iHp.=j7ƜGvixnRaŅ[7ת.iNJ$#% pz|pݭ=g|ݯpύ C]=9`8t[Gps7.#quD8s hFJQ(NRO忸FouJU#Vrtv/pG*8ρ\V~,.4Ll=-fZ:W>/7"i>ltӼuü-;4뫨][WZJ+c4봝ޥgwoKT-b{/!{8TόM<>iNjv䝿xv|K.4+-M^)Wcq18;-ݟgiWV#o~''?&LJo 6Nhݭ@gjWS_TKJ"/=]YqncWjP^d,|,U.TMR~ry=m>Yy Tv%_=EpM 2>$ l```3ͥAv qy.dMΛ*5qmyI$kt͎JSj88GJ+h6i "Csn麍: !qz6#B(XX{л7e/]emK-v ӥc–;͟h-nWZ(#ư Rks ]6F{χ7?]+G/TrPxnYq[$K_ħoǖ-I+[u )c``s9!'gZ9u>}5uuId}(~H-NFFb{O3GXw \4e53%菲 emSBj,Mikp#nߚ>? =׍fHɥy%K\p֒y8ֱ\^EԞk:Fj)G-,>!xKK,fTFC-澐q$մ?AM5X_`c.|%Pݢl{5%匮ѡqFv]&JifR]Yy5'ػ/#~gZ{huVSK%x!3l8ŷ><ۍ-k}v?Pi0`oeRr~G5ػ*w%ug+~[_2W,|R;@~28OytX'GmZe34=8%UV aia[Tҕ)ʚ2o;nöf/iqo#Or#~f4|lNѫo%wʡKvFQ6m1܎E {?ժ_,'*vv[M*79(.o|[!oBW֊X_]9eFp9TMS9ߧ,{y,EU^"Fq5 ]d5Rȵxu}_^IR*!:;Cs-nq铅׭m{Qoeo7vfP֯)FT(A6ˑs!p  Xbʉ{`l.:q'Nq=|צ5'86G>HuZ-%jE]5+GliS8ow#r qҶ:rU5w.M[J/R)u2>/-E솓][ٸs'8=Τ4z1`/ͬeK+)M0%9S iQIJ^#"qW} y?e은]nSQ98Q8kzy&jz#]O_>2Q$h`cLq^\G'I&{eHܻ4ecENz^{LjlWy({:ŗ ]SYt G/ ̩,{" LKq̝\\ӧa8#KZzюZm$2}O5l.㉜uAyi1x:v,UXχ ge#I`1%~xYS)I~hⓖ9oQZ}-TS\Y e5k{rC0v[W__z"hVKj냑[w4y\'ϐgj[EmJMLwgk~Km$G89vёOOY9Ah*iV)F22.S spQK+mdkۖ'ol-Pݢ=ڇTfxKf6w@wn-'!uNey.x冷ErPbHN{8Q_ ~.q;4-mVYٴWHGC OչЍ(Ctek,,6 cqE&EJтݑ|- 21#!w,42un8=H[CR[8ݿoCQ|}*5(j"nI8fNC8 d.2.{X` `9WFPygkJxIpӧ8V߁vN1mTO c;c~Zw,U`l":qcY٨*w  ;dIԴWtpńf0KnC-g}>}S}ie.,_>)7 %!q_o\=f2gZœ=@ԵUIs@ 5OKq|d|Է)9 d-g^_JҜ盛~"?5žQ-ϳ.+5]p|Ӄ|c?nxU%!i+pX)gk寕p$W5봔{wK1J)yroOpvg|4Q_qsˤ.٠r gaf;C uҹ@]̌\GT.*PS (ㄛlZ)2 x<{g=9%g~Nk_7N"WaüDv;<s]Z5*pӖsrig8YS{\;aҽ^j\sK>MW;y&z{E5.#1 0s:IQUBhkj.QɈ~jKKic/g#+{0#˿ vMmꢫ&m%W5xRov"r8?'::"xe[Kfc@"sZAGOscwNpӾ 5fOzghطRPZu}ӖW;@ʰP۪( -%cld(~%+urj.vy_JDa -vz9VSQRdd78z(3-Vڄ;5,bRc;,kQP:6THAWDTk'sk8Tn,IiH̶Fe4үm8Rԗ]LJnU#4fv()5/žK?\H|f; sqj{8:XɻK:HD!q'BOsiF3W4xMf)E|_I|S>5[dxtIO[ag1SG6+ 5TodapEHxjJlK;<|sZ~.i@ծZYə]$ZxNMՈ^jTE)J'9S}_YeCD*TH'p5''[{?K GTOnuT#46xcw7|9$Ӷ (+{FsnoR^HqoqT}Y>)6ג藒Gphv-j&ت;r^Wd{ _"A Lvj\#ji_8\9.% n+ӝJs\bi.%.,' chմcKR'%8[I&'#ALpb GOB_/ TG"xKdױSRT2QqMsMIOһAE6G Mf3gXj1Hƛ:vR穁}M9ZKA/LV{J.KѷeTΠSEIf7Rq$/Q' )[j_\ Lggr0l.n5gq'x(9ukڥ_oR:v%Ywe(jqkg?W'> ;g[tӍh|z3pL&+M0T@ pq sw7v1^3I/1I~Ҝ=O2œ[xSMxW:oiE?a=Gvký$ޭT'v|¼ʿiK6+z#QJhY=.kyJԩqvVe`c nҸ7"eL Wco?)xxp7Av)ER͹u%S yEUaw[.U*Kjoi&^0gsq t8s,kOwOgK+ ^X[!PVM 3LHpճnи>GKQ쳾&Ncկh'csn:+ӜEI>'.ͷB;RĜE;xaL7Z>TvPLM!#A^qVٻ^3՗ٮmpfm#-~λO_La:w`4I;}.{-:y>k$җ#jh_A>QmkWBnF p0n' X~jeySIBݏ}LsvE&!,sao;:9ma/>_>k]J^0rQ̹r9x\{H]l1QG{^pC\2cs}契͸>#bhN?%юJu m |S{o]>k4OziKB;ɿ?M?Ӱo'4TN 9spj?Tx>Bxn^>I]ˋ$%d=+M_jbRdEtKĥRے[$Dȓ~ SpMP5SFO][ȭHќ->'_uAB }XO^Ye͹pG^9l!YuG.{A(yب[TfƜS)Cxt*vZ[4χ#ήBI%D:.AO_s*vvc}۶TUCǕYGcf2_mF:|I Wfk/jٮ *0Y:>o=>PJo6XO֬zWN~^UX7Ը+!#z\~!m9|up bZ)}pNqִXgNiNu59/yS|\;qI)ŝ};MWWJ s[B;9 6+SLjwt*JWT߯ Ye9/Lφ=ݣhSe8ioy~%Upͭus'|桠UQp`Q7N]H?&'^~}VO<˚#v7p /XHΗW}Z^$WXi+x:Kӛjs1Z vdZפB~HSL.yJ,SO"TaCP)s_X*gTe?lSΥEB7*qo(lļZq/iZ9m< %nWG*tb_ [/{ oѪcB. RNp,?6[nOt\9|Şy^8p;|7)Z ^CCkF͆uMNF1_ХOZn<~/MOEE[{-'8}FM~ӆ埙m?Ezl)QQ4KmH@<6?S?n?wKgr?#LU8-ntU3:y/C!uWx/C|WCCЬ(dž*\b4JwQke-Z8N2Vpc0[Yg'KގO ƨcVUd%^>*2,/h.}FxKqp ; t_AVp Co!JOygkNپrڶwG w֞jFy475uku ߃-͠h fXAKN1ωJ%5'fB;]Sr1.<4Qmۄ,ok}NC\ZƣOl/eϵuyROD*l^iuS)?~g+EGe\YPډB4I$ xwth(N_%SkT|]ݭw%vjWvK}5jvK],)b忉rNԥ7'`ۭ8rm-K "sF+zW#D]wq)R%g]$OZUGz/5Cv zJ_2H{|;vAI~[lVQڕcN9dx(\LF̒<[}Qi󒿕e(Rs\Cl\lQjoZUF\3[׫][:^9H-88>p=#ufD8p >%Ut,4+Fvѥ-ͿG~~K lFr:2:x@|c\KCsH; @FWT=Z:-i9%?JWG-HZCNO0v\OiE(c[ =ҮG^;]9v1㢱'&QyaceJ漭j5QV3Xm/f]ߧn0p{̭27h 9t7iVi!{#infpN@ ڵ**\;= =~sN餵>6ZrMe{K şBv9_{Oh뽃oSUGrhi9-'?1.SM7)*i+ n.Ťr6]Yj4.o$k_imQ_e_guVXEH$`%7d4m[ۍ1Isbf5O _YiF4i%sS[xcsԸ5ucW8p(k~oF vw2Z|Ne;g&W@ؓd4IhY|5'3 @ ח nZym:E'ZSc-q%]Y] T6,&|]eWl`^v㒛E#Ds=6GyqeWhwɵ~g4 un%Zj+ycUӄ-xzl5ԗY$ayIf `FaOXw['X38 -m~ԟ7}|eJY$w-nuuۊQYzEZr$G~ t +ipۄR1,4ò,@9w+(RE+c-M$jQg{>7pamMɄZFxH v9兪ANkTPYΑUp'%iOOeќǟu=a5/u@kC2ޝ1;:FHPFr'/c6[տ%!s AUy,Cq [Q M\Ux>9ߥVKIzWj8\]U)m}\6~r$g FZǽXMxzsg2]{4kb;s摇M=Lds&=O'+ ^2<`ڊ8=zY;SF;w0CjV,=Ru([ޭ7Hy={r{^d_]ǽ;7>+ѳGSIT-+K?E4~VM%}Ga h.s32CÚwoUjp+q+ks'/<6_fYAPiiiR rrd9W>VO2?Rb:7-GH1 {-oAyv|:,?GBX9\kLUP$#%%`L+)o5F-gW9t[[Fb%K4zY#^bq{}->):CIY|Z= . mnt+ q֥?T\I[nkMW5;_ds3Ǹ5͜OJ˷/ȳ;<}7˔QY+G; giG75R*잕8pwKtsy~JyΣ);T 2o5ovUؖV.;.%^Xx_~tu:M_fC'fvX-0^(q(nmycܭ`k~006S͝'°ax.x<_Э)o ;G[ ằӺXL ` ;2VkZo-> e_Э*wyΒb<@ɱ$3X]OL1Ӑ<(.2!I?9.*$PÖA5YQOnB#zn8ԋ%8ןuK:^?ӉxDUayi'ǘJ hXr )vҤ4(\zp~i,.2H(j!SN+/;8k@\ ڥm-mC֖O'׾x uU<0pdcΧc*IJ/{pB7Ma?cWPkl%":K= k,ZWeS3?S#evK%]}ugRUaE9%W()(=qwnvq0e$KeGvEdA{#,g]cfY m0ڝ=~u:}[wn5YY0ّZQ#̐H >ŦQQ7$wBڝKq/f͡f>ht=aZ$.kZȞkT|ml{;_͵l|}x| )H~kSVj-m>Xeqϖ]Z.hI4э^P5S; Ҋ"";حb`pStqO_G!<4|.8FqNN]=/IW,{qO]g>$0JgD0rQ-\k_MM!] ',HKqɠm)̟՚cݵܾXx\l_a-5Nϧl%j-j-IK>G*;Uf. b\)tiRH}#Q)^VU>Z=Ӫώt> ?G+=!6};71Tc8]v\*W5}DZ쵅 p[/<|s$^|av{"K[0 6SIݴ5l\9\hǎy=UN 9ZPnxWAI#u` .D{N'7Ukn#} 5к u<L#%Ha+[Y&`LGUѱv%1V91 {x!cT|9iQ/ܠRbqĞ H&N^#AGd)YѡC2Đyq {d">E2{2CwsGgc/䧋̎ Td;G)ro ~ݠ)}dwhBtw@tAݠ w`t#IꞐ:&CQ'G`y K&tq[\SfYh#<ʏmK敲S4;P:78[VgF^߇ykVV޵WS7'\uwKws⺹ۇL@.;Ll{)ݽU,#Ykzxv)Z9iphi -ً629쵚"y+5WL$7pi]ڮ8VVՔZ\OṈcp1By9R iD2jaeRwn[xCO[ >߈/@)0C"Kt5sҚӎV9.}K#Ѿ&9tr}ǯ=G5mDh~Ue6K=SNm_ď*aBأ5H.`nmy睒S`4D$qrZ\PG9>Ygٻ/^ӊ¦6zcu˵>fp}'[mgU?]aCq: ;N55|# g2Jڼ֊ nM-1%;K>uI?SԭoʟA/#g1LI)aՌoj,HM YWO.I-)tR.)>[xVgSU<t, c2s*mc]:\I?[w:ezZE*q×=|KWtcJ-K.'snFxÞ'UGmk0lnT/]Wa8Ki#:Q6=c3ux)*ܠ$[I!V1M! w &n.'%V]96ޥ}ޟ5PVfG4w:Q=}CnP$<.#K}BÊ3Qnqn^\KSU"> k'nYC9cr6&'h2R5ypy's9EE#Dc7~gi$3*%թVłٰ`es%׸GC|c <uAqSwR4EJ<]*,4RY0Gآ `#Ep#NRNrI]mOGGBRôEj{Řqr[N@r1yjlSVX%2#߈t@/a[ƺ\K1\|:ƟTITyb>mUVT2En5)e[Fcox4!$uI9=0dsH>˥qFqx;]K] ˥59^Xd%w.Ko|/'4`Fb]E]:z(HᯎHz;>nj{X9|O`[-bQ[)K =H<#էWmEmlpX*Z[Qe;a;rYL'7t-,ഃ0m>:Ot}*1m.(c 9^/\#AklP2P`5`7';l9y+k|ollݼs<~k~e [yJ]N[©Iuk*qse}{'3|q2K J4XvbbqkgHaIjc\^Kb՟#Q1T_8sƆcYn=:3lg|x t*SXIdXz4$XqGiL}+#^ -g;`o9~"dIwPy$$# k|,a8% zUMc)y('7 QK>:iTHgeCojJ{El{K8Q<4e6Xa04oVNqf[V)UՔu5ޅRMyB˕Q|.Av^k)jwjO k muJ=썅*\Qs9lryIDYn{)MK@;KDwIl҆|+ZϚ pH!Ici&Yͬԭ'eUkxAfb8c>7L39*2Tߕi%d.쭐ұ>TS8춺6{-jO~`>]hJ d }V-џVךr5wǡ&+KGZJg,aEٱ*F^0|PNgvKګ/h0U:n+8Ӱ~&zimhgS۪l,kƦlty/u{ܣtE=&3$ehRüon9ykڎ+lwM0UWGd\GeNƯ:K-7(Y(i8VR R>w:%wn{8XQ]}FMD-~ހjѯ1^۽0=2ue]V^: pMiAbvZTOoI}<7XiFHo.n6dr2[_W,ykaWqii*KҜ)Q^xpv|gg]1(E$WI?|c<l2ux8k*Nhy^De=$,&- .uӣ*tⰒ>~,,گwRU&y>3@h7h=H'jnQPkv=NWrrIg[/v}AiSW3bg ??i΄6/IF$wX: 8k*;k%f4[x?w#P^.j#萵Lsljm'ڼѡ$~o?I/!WW$"V=sdI($RwN3ec};)w#9 ou EKb_w[i r%ZiЊ4b{k5 SȃKiՅ[^WHs61w?Et΄C9YRj?o+S./S0w9zxM,\kø0 za=%Z ;H'¾'Jg-˫YIxtyx(xv%I 36pr<^vsE%4EoX 块ԡ+> r,zu%JimW_[;H{XfEsDu#2l Q' ` k{䝝#IPr.^3Ӟ]nRotm|+;!: cIPbf448Ʈjh[Ar3HJify\}^Qۇ]tY'W Y6NW-T(ƥ*|{u\u Ww777I,xo'x#;:7}Ƴ:|wgo 1 Hhy% \=㧩tO=˚~GI+]uh)zVM.(^JU$>}?p+,UU#kd=B=o ; /,OUK 3s3 j=2~kRc8Ѷ锏Ai]h|ohu;gdV|/j_xFi#{*nIm ߬Wkyw 53!!GB}w 1yKWwecY>N4oVry!k\@{2= !;,=bG)+O%! Vё`'V9'݂c-!C7d$Zv䠜 Vl` FF(ҍR0rzvP0e9'wd`2#J4F) &FR4cd`5'= Vh6@%isOڞHliX2Y`5916@j72.'l̲`rz B+N1y ;}sV6v$ 6@>(̤"]xs$ʴf<=%=7I!ZL? cӀ%2]AcG.d:pѓ$e_EZ17G8!UxAdZi@ȍXmrb*RG]]oSWd+9hǟTVu9utUS|h<]÷6PuթcSfFƹan#>\#gtѭRy~)"]\Ԯe 0xJ>'[2~ݥ23 ^@n:è(u 'mЕc)|3Ee~8>I -/UaN %C/jpvW)goF~앵i4z5=g}?#n٧kMn;ᨅ[| D{gE'!>+ԗ3Q쵍r#⻍g%lxJZ KOSKH("K!?Ua;#HFI>VTф1ȋ$>jHo0syeë4N%N "7 xPXHQ `t2cQVT٨ݭ.ˉ%UƢV^ޛ-Ms!m7gPj"`9?aRRY:W (Hs`9wQY:B+XwK Oj R*h_@-|)*OpR{tgˑnҕx7(&0_s;tHbs|@ qu-QpTEmasuxu[*i T̴Su@>mx3Ÿ,wGY)JQY{<]saSFFɃ5y|UKW0yw._j^)&ꝯYfK*8`.^K3ɿ)$F~};As&'A/8Nӻ2CeD.SD!kG#TӌX)̎X`aQ{ߡ9gO*(,:q{ϗ#/CW&,:5 =,$c#(4ZjJ &;ghێu٩ 3Q˲򾧥vdRT^ =DApkZAys{nqF?B+7,Vh;ZNy)q.0bG<Ǒ>{9-%y 4Ӭ{vl}Ox0 :W-$S\>)*@c{Tw%@KơURO,kҗ"jTY>2qXRURrBR`d!TSx9GrV3Ƀ#s)r54G E )GO$(G$0` t1 `=F8i9 (J6d𖃞Jr00񅐏*20b^ÈDC-n ы64v'}Ԑf7T9YIgOm,8NMf; )8М>T/Eu<={~d'wcɆ>!dρ˻'d&nA#cvqrlqqk&.GiIx '`qӑ:q>x5{l6\ETA@RӷǁT*U-喛OI㻯,x_ \QdzYEf%suS E&ќpOy5RAlNP8#\"&4s?3W*\IN*{mQԭ%ݵ)n'wE54A @<5lH>\ӶNE\h16$o)ҽ:j1]ɦZ-2}R Ndj9v]#[ Ve<Z+48]]~eΚ ULK ^LtA\NoU?iz{R)ep5 ˼'SJ=uRFZn@9350z9iL`=p@䶈D̅lӤoacjr2Ӷnq|\mߢ";,/UC@ee!kZ f\ ;N1ctz)i Og3spb9 }W4kF1~ #s,sQ7ÌM}>5HN1ʑs^ZQٟ);Q1P hoR0o:]#ރ ڽNx~V'B||QܙIc̎#Οa p69nHdldMi~K[#b0s[A0կ0>}Va(ɑVq `($Ğ\=۱䲏4C2!D\Vrƾڰ)k$\9d,mkQI[2"H@ O+H1w!J5ǖI㺉Xb#fyoY3˛Td Re;3A{"VV|6<jj;Ppİ}MsIjZ%tf3Ew;nLtBi^ d,;kH<^Fu+o;,(]Ԓ|M$&xL ~0{ h1&KG ~Ŷd5fCt?IgW-:~%_64\U|_5{OrO0m@pvn/0`esQ03(ė9e2KhAsH8 ȕtF=% W<*"}Vp (HZ$ ##%aOG$h^:UpBae_1+W`k1ͺ&3QIdh_#q졺FOI5"HsqwF|*2Fr}PicE(9V=5q8^I獓ziJtgi?rp~*'=Y.9i΢==:nwQ̌.{=Uqb aec`#jI^( @H<ʑYECMtX{ #3Kh)B;eN/ejы|+࿾Yh @?WY=Hh z˟5I=#C-@dqՠYA气kXZε)p>>(WXW:YBx^ۓ wu N- ^98]ѼW9.LR h:W19#rIO]<< > p⦲_Ћu=6ϓ9a`rICv6`TO|5s{ Gƍ[$SzaOOUQ8} M4 uLlK;̖Fa#w1}ݱF:}V)͞r_)Nս6$r9y'.ՓCS+hS1y`−dyRR\g |!>$Hyʭ[7\OcZ%Bqty\~9i氧q |vgU7K܆cϖU7^"nNO8߃v[4 d%eb ywPF/-hXkso+ qs 8>J d8VD ,s@Ƀu#e)Hf5omR+J u L`%vs>+,oskyz-(w*;FIu#'{*au5;S@=y>{xY$I0A#w*ASv1|ORЭԊk->)QAOW zX4ɩ%1X|O&?8]W!GPQ}pgw^Z}]?vʎiD|r2] 5Qlnd9CKW 4jIAƝ@{+4"K#$1rh֜b3id%ŏx_g<45sȿf ۗUvYQwK󗶰Nm6]n#:pr9lJǥ\>J0{tgӻn:2_u.OjG/#\t_Oԕĸ֝X-{5 JS|MIB9]RePZ3#>N|jSBxi8VzxA`_{|m?3C\CQXu>ӞKiJUCmBH;s|># b SZh;jCΈY:*Ƿ:$;ZI{fIci氓(8oZ}E>*LôEl8_:[kdY-apL 0L 45ZsHWoR2x(͢3ްofJ/cNz#Cltnr[N1Ӝ䲭EFiVQ:wU7Jq§*.;rHR>0KSy/$4 :6(?t $!%e2>(RʱdN|MT%6FF=`#pJH'J6i#UB#3e# _3K1{$+yH슕OqEU;il+>f* wn1S`-s4oHˑj)cnG5`4`r ~-Xn}V;Z'l[`N98OSAn2 mNvOpr-`j:,ɐl5eyKZ3`eXɆIά,(*8C\0 V.sEFpQ\KA߲ٚ7Z9cE;1sfM`8oT0~&B죾RIoQF [l +,=N0i'tHTEq` 6upzY_>I y V qZ4'h|ϚOqy/*ѠsCFƥԻՎ{7wh٢]rɠ7!5̪`r`^$߶0|TZfvvܗFIm" i_62G9|䩑%yԿ?)^ӡ僋vfUVP~9v~+3R{#>[ lOVK*8=F:u:E*dzC,\s.JW!Ct^XFIpmKک%o\J}1SQkr\c8_qP\g\!|0cpi-[ 8+Csc-fu@#d ڄcǯ˾Ү5 q\b2ʎ [[v\,NTR&j:Hi .{}VO$eH=yv5h:Bi*R`lK):Yl|as/ӼVQSR I lkbelk=|qtWNGե)ih%{ p]d7\P-DnhCF#,vk'MV.i=ޖy˦ƑR K6#g;:Gmkw:.%X\<)Zi[冦~"cp3q<[gew5 8޸ey.>F7|χ8G•QS B} .{@q.@YjckJe0E>A$ '9V#rJr/'E~ ߌcJ(d+io9Ut;jm<[bl3HSG8HJ=ut9/O3r5-y'-v4 %{vȱ7lc՜ښ=kVT3,0g6QQ*{UsZ`$|T{pgY~eFqpԴ-O.MU9'ӭmAB|.Ms4mԫ V['WGj#Cn X'F5"U=NRH~ lnq%`핉U#S^p[][VҖ9҆dJ YNBp*dNzJTdv9fGĬae,AVq2W39-X`jӕݐ&7q}Քk$[yg"6*S勇ɮJ6q8[܂y(G[*Mn->QUݨ,`BUthr:F%Z `! v,`buKᣏ3(|:FGaxT-r vre43cөw]kg''Qnyݸƌ:;o%3ȧ .˰ 2 U1ek4̅Buz鷕!y_RU_w>?YRZrdo5-:ttA(.W4u1WM#:=qn~\5PD~S{Wg'SxS=~ʖJIfvVB|uO6vW6RR^} ңcv=&u}D=UBJ-] Kar8U;[\m\ԲrH`os}W-+fuFnjiƜy[R&,c&VQP45[N9rUqk@]e%6/Eqt ELp8}RY4. sPHAV}|2_/̹h8pSI)e;QNo镶>LWJpU*xu>[IyG62q O {D,+xFшpZm=LiB H kiѭ-nOكQ?TmƤ&C_1S;Ohu%߹[UJÂUV~Ɉ(AZ~83U 93Z]Hᇀ (_JߖgDN¹#P\g Jk2X1HSb-*O3Dgo䵙8( !tB3 @ 暀,dvB,!![?5N>uXɕ"-7?z?}"jvY̿Idm (V.S-&7J:*ʊWԼr`Y6{ʎ*&mE ?hm*lTi.Q0to6ފ\3c WVoI.H)~ Lks꫶l"`I9 \QD6g5(u&(ˁpC)ad 0?FJͳc}'['AP1ȅ4r7"̤HR3`Nfy]m+3 :n^QQeo){mgk}0iꬥx1ˬXTӘ6<ńV.[RB$sZz5W`UW`+}oJQn.h'-8KntL\?V%q OrQ*fkR6NAE .k\%ZK̩^}ߵ [ZH$ CMQ;]~c]Bܿ<5Ԭk=CzZj y[4tG4Bu` D0r9g UUlF$xTӊmT.]P]ǙHIK`Z&thJU .dJN:@SE;WnY!]虁NB2W%&́؀0NhikceK3O#ƝU\I&g8ŭָlT+ msZI?UborTi"]W!}Zh#jFS#EP捎 Z]a3V4-ίc n/ПKvLL)5Zm Ǿ)/O/_DZ8W? PAGܮ{h祢{\=hsN2\Gu_[,QmF!ߛg>f+hI $q41*X]HcdZچ>GEpT>$9+ʔʪJ<3/ߊ \.T2IOU1Ԇc,v$ wrFVRҹv9hw2 ǘ#+\N 2 6vN/gmo=v7FSq'Ӷv5Xs@ |;tA.C'[];xZ:v\rϯpWy- Ѱ'Jp2w7<gÏP 'h]zWUW :KߑMKCkZK=z7/,uUKKU[OY ZCr +%<y 2-N>tp*0[z?m^zt)j[u%On\>-JKdBZ $y(#: 1#::vX^^P]׸s;QX7k~'ObFwANte2[xaeRȟ͐"Ã@=<8Kztv=v߿߉~|| ⧳y*) lϴiYCOqSTH#1Z1#FOE=ϵ7 n=O^•q^qӢ$}'J)P,jN7ۧn7<Zܟ86g!#JLc CX2[3PH s@ H@  H 2 Qbᷪ-œ y/wmgQM/8nk$ZU9-eڷ-yx=]Y O6eM9 YW8+ qT~GZS[tyk'V Ĝ,V9$Z3ufI~=ec#^6S.Rؤasei..20eޅwdVp-y S*x6FD7*S]h)A8ʆ .%}Վ$**9yd0h e5 i˜I' +t Eٔ%R1BNƃ-B*;"<9*`g;,ݱ p$El%$Q;X凚# i=9gs$W'Vsi] f~dF[Zs$j.vN9Jipn1bF{`2nryGk0SY%NH@<=|:qy׎gu4TFǚ0Ѯn|p3KCxY2cLF~얜{->[˦ӭ^P>>1kY~9\No ٕ-ut4?$# x3׾--IG`m׋\n!?L4c^}-~-,X<iG8(hu4=*[ ;;5WJҒөN[۸UoQ6VOmiicdݪ3`BxauC<%e#Ï]^eLhp.>1io׸6r >9Z40y84EnƌjJK%ڒI6%}qk~rw$7^s깕^2z;/j*n.|9+}:N1t['DPln;(5mO# jhYWcbyj,pD\RJ<\q%i~)S^,,@vcM53b"TUMLic!>22 [%V2)fx2Ov<')G}+}*8N.+6x> e FQu(3]M&I3kME<YƈbXKѐ7}RԱIrf~M_w#); -mj/psc 3<{Zѣ O]MO5;k瑸pLvhjcqU_#vIMާ ˧xxcn3/žG  8 pY` X `Wso:)P.2LxNv6N9(ũyS;J.\W/ia[5K e%%-ƞu0`k(D9wzY U]`.tc!dc;@\s0VW>Xy(T17CU({h?+vwo׼q\-Ԥz;h>埍vvkt<vuvV#H+ ,FejO!&$GT e ~% 0$sdbd9 Cj ѣYB8<Σk.-8i8;-8|eZz#ou'og?}V.ӧpwNf2BB-H\)D7UE4R= ~#+1N1G803YXz e$ZF粐 Y AFIX RAdJ @ 2ԍnۚOe$tFxtc^xcvK7є̖]|RMHƝ902 9nn +xŤylg; k<9{~&½j!As#P׎5MlK.I E\Y-U͍!$54y2T៞~>GTx8[,|W}qP[8')KsQT8ө crԜj%2#*O\(•Q6W!9Ny yUM= `ƹ٣QoEnU#_59|h;^ yq-X~&ulgJ#x'8.p{Ҍߪ64$96xM;*^mh)>7W\ $<zosV Թ rhSWI>;U9[^J./sבG[fr9~͸˙۱j*n9؏\;\J;*\\pVMWy𷹹˴ Gў8Q (L(5)5ttwv_đwĮ qG ݩFQqNYtmXal2A/7:PM=T/h"AF̖0pz"l9(;j.(}}UX.3QUǡR^=6X#2r;U?qr8F-5mEL1mŲJ^8S!FNI'p],i9.w-U*^GN֊)cqCn5pV/|A+c,lz7=WTx$Б$Yd`RG3H{CebHC9k>e:^GU߱.,o{AM/[>l;dawHuDޞo6gԼvF({KحCs>쿷?h1K9g;-ՎX>w8SMX#:0p= N21Z*Z,eWaJQ{1z2BZ^i~un[$k:kjTRu(K|r?@2ջ齳率 [ 펓j ,:{$h͍;i n=pRϙuTڛLΪrjI#޻ISos9õx/]ԜI{TX~~8BhHޗ49>uMsEֳyMFuzkDh>n r=vr)`$z' 8*S2#Ʌ si{r$$ymiӔszg[q,PȜ548dl̑^/Ÿ;q%*XLmO &=9,{8R>?x61oYǁjߏn-;k_ VTKYOMN1`o( [`䝗PLLϒrOOopKu#U1q9.*!N3q*'$Sɨ|!m.i`(ZZfZ7P;|90Tu7 g$0ўY\QQܝU٧ U'9g %WHiPͱ#?.c!vX97 ոg|$9_!@q +ʸ ya !=v <}o)q8'WS_*uqsOӦyd27k-nIS$ԙp/{iqmv|Uvh9PZ0&i NS[?U=9Ç$e'~8ji#=BTED&u荴ycZ?;o=txpܗǮz]YMp>Y_\ڋYUi%-H%FKw^nNC'+?JX?Y2dƜpፕ )&5Sqi-Ŭqvw|m."~@ځ)l=6w6c^>?>oGPӔ`ko;۸6:.-㒘 57%4a>x1`ʬh64nSϢ,(5vcUMEVQ`FJ.eU"8eB58[y#.4n3'rpIr K+ eer>n!KyP<3iFs*D#u8dV|1Ye;Pso,m5o c#ƖeTEXtO19{yc#i%NIrgUwN~bᇱжY宷Cz=͵>I܇kkI3oGqb8w >| TٴۘGO\$V~G(]U{9ĵd4r@+#{Z֒|C8V[\~$T wt_,"eH3~ N!+)9'-nny^Ƭۺk׫<>oJ+Yo gw]zpPIOJg bhi6 8xHclF:"@%p |9rT]ggv*h&nX.q,tf.xϋSːlsʧEamns}`/{v4U")nVJL?yߩq2;Qa$c<a}{D>U۾Ⱦ\O+_\ҰK˿Uh7 Ԭ(=x8NZ<ќ'k:z-o垪WMeU)h.TID24?A9:}_#꽆R>k{P$ǻqrvq.UQS;1 \r:~*K<<SZֶz% dqt? )/ᚨ2)EŜ6{EÓn9ojGX!t lFu\i/2 BI=#qVTxe LXHv5wYUMNIO*K*:Ӹ> \|n :{V|jW -pvvkF|?9GZM%,@KNzfF9-i-n.l~u*,1yddbLg7bg)6J{,矩wlEڴ UWI!vu40;mC_0,TUFR8K,`i/ϐ澥M.$g]UU7X~'3_EmK=EK;&-yssH-F܅{Yum_>X񬤟]o~"GP N lwwz%H8޵nN7˱|bҴME`g`eV;A"B!'PH P~@$ |ЀH@@8BB@@BVL <֗Ynfp@s\'0 ZN}d[UkA|Gu1zڒ%B겷NIE.\)皤l4gpֲ֚yq{{eA|UJԢpۦ3Zu.~Sʒm%n{ JE> 9mQ[rs^ec_+T])¸|3;vu7gLahw>JVF3uiec#t-/sf= =j |KN%9$١C$FQ8=y.k uy)3cK2{ji(=ϟi3)P|8'+fPjX$c# nY]r(.y{.ދM(쏧P8KOK0rM6R=xGU^6j,nkIǛ)]J0-42M##\  %lkv,m]|<6%ڻU)$}t~[kH>ԴNw3iqg dkA^wǓIj*JEN-Cп\UEn⛭m޸K1nI!uqnJY<Ι #o]ںUUF_s:& R|J3a-2 U%{G5G8j(]X|^ \ 8;%#ݮ^eKz&͖w﷮4:Y` `8%]ql|SKt85}oK-V|qIm$S 6%,fcE$?l:N@K$-7F7c3o0wxYKOsLG!gct4 nG](1-Ͳ\@[F} (g|.r93ݍjJr~ ~5*x\Xe Y+7$T%JiEu%qIɣsX9+)29sd\O>g%Bn3̣ӒMƽN9ۯfRy&^XY9?8xŴIwe)jRJ@p%4.ŏ̓f>Osp,Kʔ}*x@L '#9e9$Gzs'  !' (+E 2ϢƭcߖSÞd@?h)|{YF=L *; 6Z6}|(2 ,³߼7XI=@> :lT}£e-ޛ.ԵWuew2y^$#Kɩ!m1 nvzG_TI( co4m:Z!7*t_= ¿igZh@lM5esch:s'8!9T+u\~Xj;/w&ߖ[#/t/Fs*#B\y %}#4nM4c˶zMKFXiO8߮c\T kuRc]qdܟ:ZOY69ΞCW$:t;O]ƒ|Q=e]_gWhGPVG#Q=E.Fx<,$d4HO+ե|yaO[NSg-ݥDGovJJs_l6h@} MDz+dF_pCe|mdp-v1U*P/U"mJ34SL)ۇ0rq9}9(`|t5ʫ$;T`ek$sNH l`6U,sudl7FFs)Zy$aN|֌7}e.&3y/9|/Rc#:FWݟ> {+H*LYPHʀ.I0z!&8=  @PxB! BBRE@$  H@<}E{&LɁsۚ&=~b5C3O1kcGNFaRSZ28)Q0n8 DH+W? $523?Տ~uuԩ8wVJJiKm8z>+\K }ү(BXxφZTiR|Q^X=QYQWfwr: ;翙2^j"J8ݶ'8Zo>7 YҌGckI=)¨[D#jSݘ2E>y* 7d[u`rWbqodb:;+cfe8_wz \S !2vjgO%.F0SXG%̯Kcva#)|oU/a^վlf踑#l.NuXeef4/7iG9OHJ kZq#ɸSc⽤**/RK>K)ITsCu×PioRL\Zٱ#NڞFp;}Wݭu<7R{dW:ۭ85ŠnF}{,oӫyI8:rXy\y]=ɟVu>?_SM?s-2:= ݩss۬y\Ԛ=m*.JJmiu)hi;un^vmHse3kݿ!?C-lbͰ51YWcMᤵ\|[iE''VY6,&9:@CFw'p*2 QG~Y^ʜ[xo8. Jo=&9C:l s 48g'˚kWk5ןdGkUYR)e9-r?UĵMē2(j#JwN1aΜu5NW 3C?EPUai>@ AGUjcvFcN/ln'Awm.dOHɼiNZ<%A,Kߟٜ{ 52; .Ac8;>dwL88I FȻz,`($ǺL9بF21Œ & 4mTiPO67ʕ(\dž&QHJr dvCX ϟ]8C L#aThk$V նwPinBG5Bq-: v$r+M.+E|/,qd~2M>Z*\{)oy|CsF;:)%)=.|~/ۍ5q=RRR:WFD,|!83n]zƆ=.O/侗[JZI?Y_ƪZo[xz8.M+^ͩ li yLdcZ=;kE*qJ Iuד{g9fq}#˗42Dֻ]=%EuVݚeAIm%cS7ԗvG||ݷm)EՍ xsa-/&ϡq_r6qW ~0_H{Fh(Un\{/;qiS^Ԍۓr("*;zs"u.XO mig ϒyMv)KiAU*DtqJ67}/nZ $c_i8Tvonzn|xN9ng+zy۳UdQ |O't "MA\NZ~:Gr7Zx:cUJX[,vg E-T:gs׹g kCKwVljŀ?uTŌvni*ӊ\㳓ߦ7*h)52B =7^C.5秲6'S,cg%6WZ:^{J֜&"3n_t)E~6ȁgCqϧ5~VqJǟ\tY:рZȃЕnh:q*NJϟ<%8ֵl詶 Np9a?ő~u(2QSkCBC#;`4o.&Kyi_vRjҵ(Q3m?Ts+_ kiLm=mCx VGMQNh]R5·;$ {Bqq9AAUICw=6YVY.8nTb:hr2k#B( '$5qVq٘l_6OEVZ *5a3Irlc1PI5~sN8>SY$wo8cU&<։H;m ͙Ew - }w؈+hZ̍G` 2+MKqg[ c'u0.xe*rȋ9pdk}|/QtǯWodV:]LVPY-%T SI!-!Þ&ܯ7Y)\$~.9 glXN;L3rĽ?=SĶjښl8 ;4 XzFuK[5]ޱܘZ}Wh MfG8i9FyF<.qᜟִj9bM6O2\Нq7(+MTK:yd,7$k#Z~U'I=MuDcEA3|&"An\}+PXao;mj޵:h?k MmO; p~vo 'dS? M<=4WI#"IgNK ݮ#u\=4կs !|wRoEs叻?OvJRӣ4ܚ/eqt\o[ەnЫj[cp4dR袣ian[#k\uc$Ei5Gyc5FW:7=r%=#q2 b^j%B@n~RIVEU+dy-Ǚ-}exh -W1zw}+lԣtMH٫K{LsGչءgj񑓞\V4<pԣW gcm_3c\\ nq|F,*sڌQriRLy(XCNOU %9џ՝M V:PUL5q;)rx|?ER{d!RyJ]T9!mW8J_QfCbwܬkc:y^3K:2{%[k:I1T̈c`vI8>& m4ѲP7-8'0w8_O)梣˒_Y(R9l$TymUޭku#%=4HZٹ.Ӏ3"rǀQU{Mm}yr:ݝ*.} ~k| 9Y_l< oGw/Ľ ai -:H9 c{4gMr>mJ-8š'+E{d;}ΔpEHgF=JP+dVq,/vO5QYY.*Y[jw'̵4G#G/uH?ɯ`(b8p۸-r.q3ST2 h-+@Nx-.ʟTo{sx P8G,ǒX“AvsfxC Au;NzUk IS\-[*|\+fcvq Kekj8]%$ t Xӌ;#9+zn &.Y5G%][p},ZIIg&pX[U%07F7땳[2X>i%ҵTW<:՟$le<9Q[_,ӒNn(sgu-)׻|9\ONsem-wҶ9i\q? *WxKs; >ѡ{lV?2\~5K-oߩ<.]EufS)3߻$YdsY1sjʧwZo/8MJ}RܜcmoW/ Y%墯tN{Emy -l \:Y$s%8yJzeJ%Nkثm,m\^pU<^, jzė+.Uaa|8= ~oĽ)t>inm$TE,9kXp~`oh#'QWJ3pLʝ)qJ~tw;' )28dF82$<-̪tڲr}% il9?hu$ᡛ];;2[ݷilPH4ɱ's:t{yyXQT=nn٧k|5,H款jd{F B@N n|q6>lJ2}_.vkshi9xzk-u;wʺ~W,L@0rei%چFSkxrlT?gnͧO/^pJwK TeŠoR^8.=K@tbkc 7$?tdgX5۵\u\jЕRSaQk|V礣qNYE˛m4DQdpM\)AYMQqEO+A5ډ@3#bȍ 7ZY_ 0ޣ^5M&<}5WK<5N:=lNi$x@{yO')pg8㍑ivV9^J$ &kE-⪈*(epɩF6507 t91mjJZuWgο ˊRr G,vK۽}hҵD;aÞmKG] n3~MJ(зqQ#Ԟqis 5 =;ܣ%@|Np[](nKD۫iGUSR6Z 䉚Q1 3#+&ױn!l^nēu\ZcI8aguO ~F7gmW.*VupS Y6dFO=N:v 2H\t *Ɣ(4,mx#k76bSғN^>Igo m'f4O%-[" jKN\"\y=:Eps)0wBbn>uY4F em .\0ס][fgܨdT1k @[c<q7lKw(S1gsOݽP'Ec|2sw jSo'VDu>ncjd C.=9:}*(;[N[FU7kAlʵW|~qA\{Z T8 eZ 弰M*1 󆸸R^9yǦ u E[Uk2%w' gl{2FN4F),u 1Y0k,,ab&%.Fot\Ӈ79RD&-X}KQZ^M+z9=ۀ[nWr)EqKcֳ$;53/- :T^㕿3[av̕l7&ipߒR Q ]6 LPk3 h ĂѶ< `q\ցnzOȓ|b$pH7ʉ5 {8ʓѥ=VՁ!HS@-U-l=Yc$Mto8uyQR2s$.O|7-'|xF7gjEK oaikUC|۾mg_2(ZrSN$'c\AÍEVyE(d lc׃ӯr7 }e,G\Ms~8p^T}-j_n?hhչ^:HK1kE4$7RPD($ P#=]i-Sc]USlSCb#h.Lffz#VBJҪ7\40L/>j9[Q8y&DcZ=We>z.L+FtsD>K|hE{s<f~\Eq%mlͽXkfKKWxQso5YVc|Mlie3r܎;gi L2$1Q*ʞ 3daR63JZ9@79񱄷1Vp2| e59 #eQIwSku n:sß{Յ[סV0ϟ xSӭC Tb21 w^gNdӌsR3qX^-iN% kz*$wV>UJ^+ 9Kl) ʁX}94DG }Biw>ryTNS^,j! صAa8T$ZDZsN%4׆عӲ*I-dn8Gi'%-g.|gZGd%;djM(nVa>\ĸ*LLöi8i5pP*Ms5Ko#k$}Dpsu4ˎ0rQʩ#Zc l6^;qVr8LmV+XŸ8-X38cx\<Ξ2_ZH :gOUkU.gӬhiT,.lV>YgG6y;6<$˷+)^CǑ]Z8]MY|kch-;cPVVd𺔩o7r^SR7}d|7Vm4 paK,6Y;ӓjqϒf6x ܂ڱv\ۆ9J`Te 䰪F ފSkBÝݜds٘I9u_nԏ>JjSn Y,_)mn3q U[ŲLIZ_ $qyIF8ɹ6.#>ESbk_aQO\vrPRYÑu>GRqU p-oGv?Irz}K-lJVFZF;!E8'cSUd*q^}JԜauS(/AKlFeY`s[$1޴c-:F3'~]v7k9X~EJ.z5>oWvƵl: b弄`Hy|}{Bkog5?}jpyX5?ݮ|>LW>Zj{ l H[⬢cs})kt^gÛ~#c kZյ|?ϩ͗,\oQ  WB%F],Im\u*ο swyy=gjhQ{~nxS[V&i\bGΜw)=ZtkҺUIN{'K7F\kEg_#^;;k6hzZ#k[;-o9 .zӭNqj.?|Υ=^SJs),]]oU[Yq(޸7XkI>NzѲ= 8@Kl_uʭ:Γea\;yZJ;RYK\ZߑᗁeA馢5+u81ŨK2s5@@'8!qh*8㗟S4K}ayy-kRFN5+hN XjT=njhnKgs"Z7rBkv\b Z0`;2dcj%)/.^>+ϡVl!D`hVYɭo {ח;'bP#|sHzeaǜˋ[odÉA9=_Ԝqw6%%Hz궶)ok\+d&`y>9zFޫTc;sַ~|Mm'GWOBp)Lv硡ۼgSOC#:SqDŽ^3K,ިVII<|sT M;OKG®!X`5k 'rC@=JYVj;X9&}[v0j]TPYil%nHm}pE]ڪ;EZP+kc"G:9JUژ6]P4}zwG:Ԍq,|>;OigoQŋk].8~.avŬqpJ6FCSU#.!^6n(psUӱRK[hi3<[1 rp>ͽH2vk~gBqKD8^T2]qmz9?Y-q@ "xZƌ|K  ܃%Ii)]$Wî<9r)e?GKG۽MBGAImnak_x~C`i ; q=>E:z1IMln2c5:Xi$9pVD";ZgA cHkv@ȪjKn\IR4{ɦ]8[f*5,Tʙ |Nc_)9!$ac{u1 q,uǙZĨqJ}g)Eg>y3Z*o. C~ ;S{ k9 !8kKFyirT'~~^ryV|7~=j~O6/s,LNp`7'FO,e煏3if%L6( PUmcLnKs0r歬:ьYyxO+ESV}]md{#oYIdY0;ArƝ9\Uo*—Mp}l'RڸvW]xw74;B 0_6M6c$vPuӫ_ YsC볺j5mI5I8]CqױAyuus(4S:Lb~ePq$J$nKqTRT7:aܥ5?&y^Wii(xbJ] ,k) .#6pKږ9m:!9E#{0yoqIyW7^)4’7dr1I# "Z֒ѓer^$s:vNO[g?@x4r6JǴ: 4A_8f fC5G(-$8Yjs– z>CYԭ=98엵~m̓Nq% :97ι:r>3S]yl<ֻ;:7'JiKxo)c^z﷫muTClw!<цF:g9Z'|ye%,-gBm:SI%ש]$0T;{{ɖBy=P1kVoufGSY_ D(*S8W*߅.<#=@&kFIqkg'c eC0݀܇evҥpKyg˭CEӧYUOK <9<^GUPPˇ K ,I쟖2gfeF˅7Wf!2#k;)$itn!s1I hɹc#E=T’X3{ŒOpǂ0d{z-pXYvNRSieg ? s^b{@w"##pF(u qds۪a'D q~4/}fH#b +L [;F˹Z"RKcNyec9 >n229n97HsATd91y[{>TlMkO8lɠ2NA,KKv#&Aù "AH 55fLE#|$o3}ڛ]ܢ_E|G=We9-G/?vI+l~M-cstfOnp#8jhB穨tTϛ[+-s8 tg m“ߣki}M8~vퟱ袵K<8 U !΄޸4?XZNwvDnyrI/6U,~XX?\v[QqQo l>~me.}mvܡƷFְnddg|'v^NHINJiZ33XiI$YzJ$ VA0H&aXXYp23O,{ѺҌd~JTHc$Fl]eS1rF&&Dn}Ո}MN%Eow;]#QFU} 1Qcqq?uf+7- v~O3uls7dDr);=]̅7>k7dJJ֎x[,d?5]ׂV(7=J-G߆qMn7%>sysKYL*`N鑞Q@uQj 2ϺcD` U,o;FB޸4ɡ2gEaTS9,ci ZpYU*4bnS0qAv ScL.;@݂k]&C`eX04-~AmTic\UC_.N=thTd+Վ..vɤт 靳s7C߹ҵ2cd/[T 9qpGCo^T:m56=_rֲI4\ Nbak[Z35]K=+M 1jkXїFpNPEus3;ܸH3Nf֞YkT;b{\Z<4\җ2]偎kbssA TG&CH;#56L_tẏ7;[+:sݭO2O,aǗA)Z4nT jGsmTrb[[,WD ass@7FsYkUi\>+:6~hdպ0LM'u֡;^c2H쪹IMXLkgRp4tڭ E-Zw9„yYQqݢNYWa߼7V˄/VKi!7y7j}nti-h>l'`} 8"-{Cznq|Qe5<"Hm5NF pZ5vK$y].u7Eɗ*f*A7[c|u!tsJ~<ΗsMזGAvȜD<ӑ.Nb{sߖzIֳAo=T({NYɶTe 8+CYԥR/ ZpJIfJ<1r*5[沤8vԃTy HS=5[\ܝyۆ#) ͤ= Q JTdp|G$rՉ\v +|\-gV[bHI$[UM̮DZVᗓ;>>l1!B9}+[DPBz֔WNxO/7GzXENPk r%^1݈ec6Z摷.RxNx$T:fS@Ft7:qdQD Aj7|s OE!KkVOg>wi k)ܸKgRKgq7gPZchfJ c܋ya#c9P[]s+Sv[<6_#f4Ooec/2zm/lmk>FV:V5f屍,.:F^uln4}ry J4+8Ec -Zgy٧\gRPՖU `kcXp7*੩E+%d- w/C5ULoyY4sIv%Չ2ZC )*K1,sş {9I/=r.{.͏xqvXq7 Uݮ M$w7VANdc2F c' p w[]1|m,,i8vD,g ./M5N򜤚xۮTS;$*aK&dgdGD:t;wԳ7-EэDݿ7]EJ_pO.xy'`և2M{$~6ouvޕ8˼'߯Jqugs9cIhӚ0~GzW7ڢvXYmc%kh0:3Ovss5imELш)EEETh1bh?+[r+ ZyB '.K~_ TԨ-Gg,wݩ EwtZ#LԄlMA9P v>ʵpr{sOhwWQxߓX6-X+#7% {tENC9 <nJRWw}VӚdgemmi.|I5À,-98:z9VduIJMœ)<,|/WN'QV]{[;g 1dHi2G4 nỺ캖{ǯÖ2N]Ԥ<[]ҲIaSiv>!,'@kcN20z$ї0ER4Jj-$,y/BqDz{c[x~IUN"X!|-d -.pdkt0Ne8TNQ:Vpګ +;F9RN۟jK }}rF偭|6vg.n\K4 s0/5ugZXv}ݨkΤ9IjRmc%x<7Nͯև:9h lldvsrXScsϛ loUuBjʑA>QU2e)/46_s[T9k#ORڀ`sn:2GeôrEAG-5ǚY#RaGQiTŒךrsR~ Mp\4+nn4wFֳg22ֵ۸|+ak_6 ?322jwc|`NU&oo/[\QHٮS܅] YXiLqarge8aPW 59(tM?%?aCM},l!-swñCL@a+(Z. O T]wJ5³$Z;;:Oh(I1v7LtZupgY ^('*TϥZqR :?8ce/㿩[ciFU0/eM%[^d# {m$6ZJ9 g}1]H-> ('(-vIhÀɉ$;9%;GMaγZsK/>~M@2wos6r?tR5`|+Zgqג[Be;LvXӗ xJi9۫0i/g'.z=qML(} C$67388h|ֶgc]2 0O7Z6Z%)feѪᇎX5K$jkd곖"csApB:~ɤOlqOx1*«1:Ϋs"ӌ`1Qmߐ[sxoj~(Y+c3E H8;Cԅq%k.o:Wak#Z=7|cAڸԩx4<*=Hq .NI'Þ5g1zn/},6{H,k$x -8!qͷ^l4u:NrdFI"Pq[iƣY\2{];=唷a Ǽ9KvdcQ'x鑟_,'TR~|Y{>[tO#e;kb3v&G0dN9颏%%$l5NgmʔvZsfH;7?cES yM!D,YX-}ZF<6 VWR#5lI%>PFߔb6|RȓG PAWnF++x|+p5<Ѫ5i\3HVjF)p.~y+]S{`Ulla`mY*{khOT):|HgsIl|T63{-OOڨ6 >Cs궨$bmllg&$YSV/%c0 %lG* DNjt Vԗ(>˽9$[Y3Nd2US6&~#}>r,WV3Kdy +&q ؙ.x6뮿Rugm|%I Uv|[ic&p s*J W eek\H˓,AدY^eDk2qp4=Ϫهܚ|*UmyeU<bF)AP8f2 3k`3@ҒM8n+*"Y"t|SqEIpTY8" v<9nZU̫-$ƗCGy rc96vY3O,:Y_`R] vzқm kj[gr`D2:uFuO;ԭh"QU] )Xȶn\G@9%͛زU~VZI6MK1yqO 2_c< %$do6l-p+{>g7v-|kèɳ<[%!-Eu`Z } ts\!CTtX#vV몉۟r':bA o+%SFOU:|` G\Fe`oxRuNd}SC_+N5:^L(,)Bb_ gcoe%s28IZ^YÍk<8mYrRm,CNZt$l1QU(u`2pZ3+[)&JtMy;9ӫ)S|TߵJ[PPxy $ 8/>`7o%+b63k:=|6rrOm3ߎ?4׊>(^x~NnSEyU]0uj9Ŕ$ ]F\䍚*%+>13~g61J()U Bp,c-K>Rg;e캊ð߯ sa( H,$VZ@!/㍇m/܌ϖǺP]b>xGygw{quU;=uf)&TTlO{ 7kr<'w/s9}_d%uAIGoyq=xr*Z&RKk${@g^CS&9nvEqF -3K״BMSxugv7Y8*X/9¯ۥec $෗2=-d9KmJu V.R)F~l]? S]?y8iVC߼cFzn|kHNXqV'99a%ÏWYnkW)`G ׭dFz>2=ye2ƈWYN B?ŕV:4m V\өS8]D來k=p>Ü \`&u$IXv7pG$6‘4Sw\LH/}. <ˉ#8 0[$sˡ8XRS{Ko Գ؊ ,+cZ ced*KD&^P%)<ZV$]-ª`U::#)n?GQˉ'I 9<捐+Jg_vmzq8YV)uEM-%0 òn{VwoBU:ҩQO;g+> [u^]~;gYt⫇ޛ%!IZ sb i9; T,qH5i{+St'MP~ E:*jw ߛ[|w Up\<%CnK$w?hmE]T18aHh0qG-[UY6R}vt,ZK\mn409Ij&qnZ#F2䆌)plxC녩UVo=66ݵV7gY|zs};HuzTi*<,q?>QxIU%U֢M6BkZNbCioSS3β6Uֲ,GyR8kuJ|2{zfNΨ8SwJ{nZNLd]1nW \ť O;Z 44%$7?Vtݷy'>',Jn\k2 Jz d8ic:6##ry- 9cH9.iƼab[~iZUyZBSyyX1YR۸t馢=0ևsG+< ,':XN.e7|M ^9'u;^}jŧ'c9 Mݣ64p]x4G6W}bPt.^Sl{o{ ~֫Z Cuku4_F:FjcpF\<[+({Ϧ2ov^cQGBv][N9oχ~]w>ZG8]7$9Gq,<>kc^5ӲٵTSCKAp=,xh_D>&|'Jx^Dl7n0,Kʻ-U ULem{Ld6 pG?Hq<%xˆ!Q3V64a;nO/n9t|Yi؃Ӫ%۟BT..q]LG,~4~K|mSUt7|D5D3\0}o$ ~lYjw%${o""p)`ّʈN*ʡ7С;Q RJῄ-\)PoFЎ\wzSU*.fMy drUzP{"x݆ʳ:H ʐV4;e2[15b8oud80yR|"q; {n847cIQq=Vȣs7a`@yN~¶9$Em!e; Kk|T3πƓE^UÙfjkcM2Nz*n(GM|Ȣ  XW^j^m<3v5[Q1uw¹槒|ӚܻIb|iF3>즒QYBNY'Fs'|mv>%'-sqK$c*#~K}xi-.IlQ>U<7. 3nes_$ j؟*q)a֛K;aj23oF@»:&4L̻|\ˮ&RGNׁG2oԦ6W4Ƿx֐O\/#=Z\G$5fC647IY 霅p>"T H邴s?fR1Iftk| H5HeYFdx:cov-;c֌xD2*<̐Fm,Ѷ*HkZ܀5S_^-Ҵn)S+F}R1^osq+xB#K_CPjK'Qt`gp=ҷO_t}54v֗HGzʎ]!>VRJsWmJR=\x}xEyYdӵ x塳:p*%7y$>8$gsp~cnʔ.YfR;hpomZ;d=GGx]l26UN2ÂK#x{`ioj|U'tV3GW3':Z6[Y&:k~ qE;R=isΆ`oĕݛH N&*pKN uaVxj?3[ZeQexopuNw9In-w H;i>3^OI'-:i)>{o13U8cs57FDZ=IܮbUNv|ɭZ>VOtGG2U';?PX1U׽nʤKR;6=rji7rsSКg-,Xec1Ap-ESω Jci6[`II - `sG E5E؁*)ԩ-S[e]3驠C@$sթ~K_J[Դ粶(9횞:˩AeW520lUoq%-JN#ZN8hehgZ5$2T>YKsvi-"Nj`lIo/<4~j꒺RƘesuI uR;tnV6rۈ觰P.aŐ6Ggl?nUgԺ3ί^^i)hNݚX=rA'c̍U;P wBfl?T#h{ `COcԱu]ƃ*B?71 yOz$h+M=ΡrhkZO[ ~Þ:*.M(8rjkŐkpKang"d-*htoncxu\blOr2Zy\ݜ30vYgt3Kv>VJNWmgJc2gXSXX' v_":=qpzچi#Yiج)nc+_JĻ'.4Jk*K>AJÝx97+ wSr1a, Ϻ:@_q̌gQJTV7_u.TvrJ !OB1}}7kC޴OmmgWgQЯw3$sN'[#G q&'S50}3{$aǻaa'Ψk;Dà|ē#EZ:8ip-d)*\ XirM5qgS1JN*&רa@؜H-vkJ'״=F3Lr\Z58|6/%=eeիMs4qyӋ&)"|Qf}60THm=dBLgh``Xݼ=3WhTiI_z`kWޯ65U{a|N%W; ȭ#{Z2FUqv)խq|O3д*6ӭ.rdO;jkA_ j~AWsIQ(-舮"q%i/ye͑˲Kr{49pIIEyG >kt:{Ô6iizjorFYk9T2Xsvd#eH>Ga.j4gJj!WՂA.`Tj8Ɩ~8xi؏9JI‹߱*1ꭗ,=|j.7VZxfwr9ͮP>jYLZ3 QRp'wk^MwwRIr1M_}қK}FN Lgh픆/c-TsOB|z˛m0AO! 9wTҭ qRx~5WVAQsq4Uϻ*3mEZ㢗W6 +PL\G/w[oe|^\,muVk,s@sZs'mN. $xskUǍ/HwK jOV<[?L|?eYbMuOOHh{*2׼w1q:v|`wMcr^irz9ρfVQӋ%ɢQemMmt<*gՖI X :2 ұRNwkצQmF:j^ʒKfb쓉W^xf C櫉{#˷#Ô˵c)V+g *Oouݯ9,ӵUaS G};g>clUqOb4Ie%6P49 wN{${GuTJR,?rԞiAWFkIpx%㜐mnר>"ޮJy\-2ME^atiM!#po-#N\Qt[.Lzf)%BT8<{Roq|? kmKꩮ$8c͒'G5X7-y.h8(,z}ΉBumB5;)7K*2rk'q%ZJzZZ~; .h`8k\R6F19q،lD?[ewt!N\\ n]AiRݩ*im3ꋥhwχ<%`XBV ]Ĩw✨>(żK-?H3+ ͉͌1aȜ!9a.#=UYx}S]Rx3KLwiiZ\)0FOӺLjvђ*4YV;)'N/ۅt7qYiU"Sl2Ψnڀo \ӍYs-Hou[1G*5+5s*uT*lܲ׉ew~ eY@Ki4`KZ>l2ltr7<_Ȭi8aջZRU$O3kȓK MQ`I dn#@n̟5yisr+/_}:'ˢLq.%S-|l!crIuispXl1=Ru7[Y=0\5M;-uLc@ l m``-8Ư8-N΢cJ1i?.~IY=eQk9Sp:6XKPƃ2UڝdF9iȌCMVXIѿҵxU7 (д=Ӳg*=k\9aá^e|Cvlx y/Z]}۹J*\?|:O}ʛxs/dF}_n_4&^'_U-M͚74>I$3Kp>Wwdh6G!66$%r/Un5dy^K ”kH'’ģ4<Wi!-UtVMYGqmETRqhry Zs̮(c=JҒ9FGZ__Q#t oVF r85me:\Q |7d9"NfYnZ$,6NFM̡7zX[l-_|En\J깤>'&췪4%MBNLHɣߚ]̜).F*ݼ -n<40QcŖ o! nJfu,1[XHZ!sH k:J+#4VAoL3N+ :jKv$oze&-kZ67;dD,8$gj:) >H{e d .'q>|sc-%rG^GRgϡ}_r+{Heg'EŽ*˅OuSagt0 Zg>N:~4>^k֑Е+#hۡa16uƹdoLbkK[)v$8y%d$uG :ђIZ:0enbewNg}Vms^9fq $$U? e,S's2最@z-5޽g c1;߆kG$xᣞ6ԆS@#apl-xqen =$tϨp%JKfGl5p5Ru}Y+ǎa<jos2։ۭaܭo,)G$Ud N ]Ds1MI=wm.2is?qihFBNKsd\:fc-יxM$&=.iA<ե`-ʛ\vJ{ͮ,JH>Z{p:+q K,JJR񴓐aZv\[e+xf^D]LH,+[bJzXCU}sb7sHﺻnQx8ڎ#Ek84>fmsEgOl`[u`^Fq]Y⽨4œEi5TSG4 r7z§DFkIYա8&䰲~+x-W'hY>Q <lsÁWU{R++s^ nַЍ I;mZ \9|<{e5ˑQ+f5'NTY^ܚ[Xi=i=Ĝ7-kpx-6ʹb7KCOqTU"VDiƢ39.uޛ9Syc++jѶpW񼔸gZz\O򣅨.Rv{PdMMoʪ>7uNJ`p9al98U)W-E4a{-27 [N0sJ2}s*$tiVVJI$ qvG2en0vqW-YeW)ZVv\}Op.B0қu4uŞCe[` Ggouشns'MZަ*pvqតٗf|91U\x:uƔ%4UQjپ p3CPcH$ihmzgN{ӹ~qYNPW~ϳ :,߆|EUV,d{~3wZ!ß\^Q%hǢ}Y5h[Xs%)([.mCx⛜ppMlwyp8=woVX5У*3Kr-[ju9XiJM%0~ShVwZUvUCmcɩWќ~kInNFwd17j[9k=;FlyGM?5# PxIlcꈽ3W'pr#0;dc+OڨATO+ko?{TF'(5.e#mWV] MXjWE7T{`3B1܏j74#SN;\Izdk=x>UѿDNZVәYn(`oݶLIZi%5Y^u*ӕHm3S!ά$ۓNj{#W)V%۝j}h H@. jP䮢s~ yoȯZNZN3pix~[n}oM{UW[h_nld1 r6IqsƑ0p6M@|GK"kYIΓ7\˚(Qn<]1^ZUQセo)/g>#48wOF&xFG$8a$ORY,o:ơps;8qͽs-J9q즒Ϫ[Nn9}Ed*X^kE\쮹M7p.` ֝/i#q> qٚ5*jvv5;|WGڎN]UN–ͬI럇Co|wXԬgG_Yr{t-sdېߖN1"s| xUƺt> OYk;vݪu1e/X&qIsrfj*_\i8/<@go907bVzFSދm6~[ R$O./ uzOd~ʸ7mtO[U]EUu$i>7A0.#${.Mn:ӔeM8k?E6~<{9٦<}(q' U!jeoCI?[]im[t\~SۢWPhJ^[k+ZVmn)eI5(^R^z whaEɉEJH _ dݼDEYtniGR+)T0o9=L~ЪVIi6\Th09q $nKK9PzWV/>MMvѡ( %(9Ic9/Mn⊛%TsN-C6RJnAvR#&48`cM׬ZյyEץiS'V\2M(?yD*8n6➾:1P&xuH sikJ_%ޣgViRkXM}͞ZH-)q׋jKo-?yp/SL;8nYC򃍺!Xvڞ}+> (N;5 shRPSyO;ȸOښkw [J4ڴFF;jp- آ:di8}WWwKk~}VF0ģ2O?FxcCUՕqmҦF)oYk4U ƒi'uHFt5S:+ht˅7>G׻Q}Κ&O5G~ <;m-ikhoXqlvE =p0ၕ)򖱻e^-WyZMr{mrS̕:SPOmœ}M׈8~7hwm\bkM~uEfGI" hq9'{*g(rY\6gTujt^K9az3s>jN FEWA07 2j|><E @8%Fqf/K+jkge폴q=Uk6FjXn-/nCq'9-Ov An6^=t|xʯ}coS;%٣njwEXڦL\9@05 [ ?:dK/W/gUA(J8)ç}7Gx0=w0pKK6깮SIR</N5KT҅yǺy?C[Ⳃ8jO{掎9g9 :5}6և('Y=>j]f<\8>c؇-VK RU6!ivy8Cp~l尴i EJ ΊM$~ c-ֺNӜmǛ|O|HwBMu,cLC#MKGv]s `o6(ֱ3zB4%BI'i굯iָM^8j?S>ŠxPQ#'QGܽä`|9w?@#ɾKΝs'mGKtWm)G+r_O<٥|C?xT?'mcQF 'X]{zV4 D[Ҝ`qYGo=RX UMU[35<-.c ))p+t9wO静vZu#>xnģ員~rpQDcVU1p88`nF=V݃.#'֍OF7,xdF/ 9kI@q<'d";n!۩͞@7R7o&i;:0FJs*żio 4m굗ѡt!+6CFyaͼ&%`*dvp VudEN *<^$-NK$4'󠎘.f-a>y*EMո}Va+:ճ^ ʸh,jo[Lux}Uz<ͳA~),|ȍ'ir.gtjۓ)x |*y9:r6hU#.DK%oF^$.}Fck,)DJ&kTqɄtדnBqz(xdO~e9u[#chu- T[ys7HKYOmX$@ @den l X>w7Y(&Cfl;jlRJvccziFYNȆ2uu;-:R dc՝GmX_9`Ps|ϐpqJ~7nMTWES;>;HsA>Y z'?Gjrþ޿%6 idlNd-nȕ/VZ1.;sE %"?StZt2}|kz? /@oݣǜ.6SӀ5֛i#hso+;xG^u>D5: j4pGܽI$jUU'Rp ۩L<?$ߙl % ,k$'$nGS_\Y&fB+*W>ikTY^@@#3{I{9gc-M .9p %uT͈z|aԒ$B{5U"LSZ|.#켣|IBi&;'LuL%$|wM]q4UQ eMIJ;Y:B-UGFITryo'Y"m1teKKX \ԕxh-Nbt8p0'Y7F1;ΩNQۢES\G< R6"5JFs䂃fumE n:yJw-48iyhp;," SYDO u9hxyPV_tiG4w.MwnxΖ$0=Wr0<`*x;n-.rK-r'ϑQjLt{XΤǿ yY{.{ΦoZu$oiOv<58 `"J` j/vэW+j\;es:^HZq.9-9'N5YFypUZKބe(6K;e`7SQRP'&7v>&`cu)n<g͢=;Q5o[)oRT~mJ\vd/6^#|آޝ3 sfZcMǼ_MIP\oeR-yO}Qt"kILfw[nsFd[CPN$Dy kNeq"Qz,g~:=Y=l ڡqS;81I c=VɃ\ָqDzѭ RUTxeNC3;TuZJY'^^Q_b{RU4)9CtDVlijEcy-Ⱦֵ=J 繫Nqϒic͢{(YAt4Ő2H C!akIh '-3U ocXmNёs佝BU{߆|JyS2Q9E/>x t[uHҷMʭƢs#cНe/2TH3/q@}G+tm~m¥7se6˒Il&PvvKvifII[=,VAO =oc{Ǚ r&eUZg@X׉&1đ\KVs'ϣ/Ӽm* I&oy^QfW8 PE=m5ͭ~\kj:5-*w6bڦ̌dEygm]xa6S[;* )J2[%q=gq7 ]{8Y)S[% =-4c[7$cÌO;RXV+m/o:hƤuN)gPdž"*Vatma˄JI%1 l 2^kwzKwFt!Ϛjz Ѽ5ӽʖq9EpoeV^3-V*\EE@kZ&\"lPx0nrYjtNS+/hAwNjWp獼W\8r[QztmeU!|@js|@wc|__-ƖI~ <AWB:kzr^>ZK4xc9Y? $}/09R*;S,wPT\p״84.o6L>7xIXBWftݴj;$"rn>w_nk[ $:17X1'6=osuc}Ǘ{Ӓc)秓4*nZhJ8w8i>+c퓵}oh%g0Zݻ#{\ $d[K:cZӭ *\Rm7_ϡhBu8cѦ^O̰Y$87ӰaancKXX}qo/fnNN &*SP|=C7wj׮.j)!V/5Y `rw&7r1 ɫn8V816'nX¤8V0VsO#8'/N2 Կ[=-WU6PG#τ|XѭmUkДcNNNX9e`i älN)ӭTnKT CV=͵7U9qoWת-seq #b d9x5gl&H@7S@wҺ}ӧNƖ$i7!y9/$ٝr{E~Sqǧ}pBt_*.V9pM s݀O \ ꣋a=-nF2ᒹl{-$sj׫7xX=Qh5/+ېzmgĔ/L~LF$"sb y,'8gcX|Br e`c͛!JRb5dbw=>yiMy4[0;}6 }Tas45O6gړfB+ œq?eĐIv<(lsVsdֵC,|L)I0$-xl:p#I[aNvUkޖ$y)$|ܴ!Լjʞ4ݕYVij8'E#NOZWx6ppkdRc  5Nd#$`q5'';,#dv4S!Ė.G2Uf{?ue̹{(2ueY:2V_*Wr*=>C31*Ah nhq'`0On|gsVoV. sjC`䣺6$8kjZ!E!r[lI:[b{Ii &&R7:!gҤ2i`޸< ֱ(LNK@eo녬ӫ~Ijj%2[IeCGZ'9fɳfKA-.h[G#eē>Jv@b:ȁn1ydo$.;d"<7I9"z v1Uhn:1Yd69qKKLx5'Qω^SӃ{$zfhK.Cu.]I0 lxYcIw!3FN^K"u2VHvsUWc5E 8h;Z5> OF͉wr&Hښ<,qD[F,D^Ilaz3^Z̚ٸn}4YR/ZF c ϑXeyd4kd*Ʒ{zOc|T,|Š3:rz{gfmOˁUlyqn0Qܩf8c8Fܺ)d437&})sqc70۞]QCS ηgVgs&;mb/%_^M`mM4nY1 |JR$gH hnsk9J^>(ݍ' P:]q ݕSO@y- Ngt3EDG~i#<歭Oi;dU*ggfyM6%}TR }必}TΒN R}277gm9 #Q̐7 gvw='}J0#ʻ{K{ɾ*30*)r1hϓ=Gn1K 'nod:ݐNx#--K`}抒0z*yД8Nțͫ /6! le`Csឋ4ٙψM= |Ud;h?eO j0c ^F2k"!;`!O)It4HApun2?9 rYi s4ܦ9WZp ,5o7 ['p>({Hy|9(Ђ# ^*ZCy=e5YIo^2GCik"$TݕSUl>8㭭՜?5o3eZ"3-Ш29>Kzsߑ|Rƶ]ሡo;sU0w}VkDcXau48w5IWgulrZ de)]l|WJb }$Qlj6?~c4iѪΤޭu~Oh;7}U (g8^עiNI.'f 6gUc7e9DŽ.S[=8e-; ®6j4nvs-s.]J )[~.muZ5#Fs%Wdg8,_-PwqIK<摕-u]Z*) ]y%F q:#ow)ok'M5((/kZVAs..Vז7[֧ip^d3MxcѬ?R~ =;GR^y;,C]#w{trUM9I?vwҧBJiG-ErxoSǒ/xbzɻe9ӟ}Sd#瑦=q;,gcTE}$%7F^MzrKI[2 㙢iCmd"l`qi uro=wIiŒFa4bdUoF*w\;'?w #Á3~πZƗ9'kUԚ햫B']G8yko,"=Jڪz6?t66I Nm"s>9RG_sBWIFXݩ)'|򺩥+=(8p[=DZvO1lsH6OX9H-'(zfVdƬxsWݳsIpygϧ3(VJH|~+b\E$cڛ[e9psGJT k|CIh!Zh"^l3M3@x-]JQm(f;,_G:gZjt(”a5Iu[5:Np~G%+ފ!I)0ҸX\~<hm-"7AOW qk,icOG7N!(N“<쮭nI/{Jj 6rOSKmسK_l֎~0_+,J˥mEiaw ;9\r *e) 54Uɉ_ ;ip' ñO.eQnWzSQ%s$6:.QmqoZϊcTGmgl-f1uE8vkš ]?U$MJU*nϋOFM7;>8O+U5}Eˊ&v zgJ],yg=C ,BydҫTÜkeg(=6Tg7J__ SgEf oP2*e⤕6_ G.>9h9-.kX9?%ͩ_pQX{d6UnϺuBUjiԴR¨/[yI8tk'}Eh7e>0onFӳ :'295-)v qz; 4w^ۦݚ]-8MUF5Sp8rF1.|rZO%YhATf$Ӓ\Iao쵒٨k)/S-'KQwڤI8t{A8Ñ)WmR:\g)_PVM찒Mogge#q1ĴR.u70_NZHy``k;-UXKui<} IP0K1凙,z \M%Ҟ)%-}Ee%ʞUY2!{\94y>7ǩ9^^v듔yls<ѸTcsݼcmwN}]r[ hBʸgi~7loґ-hlWmAx9_-zj{ty:|4o~-x3v;=xNVZ^ dme`S2`0~wZƅIacn<҃ʗ~hWƶX,.t塞|x"=GK3z ;憕\5|;Mƚ)n5Y=]SQ&W?oc9 ,in#O6hr21N1 d Z1Um(ɼ?ese9r1Ձlep X\˵);j.of+. /LX2Jn:TN2t,JP 8X梮'h{ea>Y[Dqɹr&zx[ҧ$ rɍOjtߢ.- ?luj{iA KQX u甡YM@ Pbh˶XTc2g!s2j{.$$\\^QOgz(" Uil䬬5,3pY6Ғȭmk}ݾPfsiAoW%N(WoN_ڒ$N?_傺[? \^ޗ##G X+vhTZSҙ4ԭۢa!;.FQS?GKvhoM!XڝO#K)))3BTc 5Åe7GNة׌I]K[u*᳆vYd 9kG3W-=tP4Bև~{Ǖz_W5kٮAb#L;goˉ'?}%;(qMnMbW{x}+Aըi~w8 ][|ӝlBZ9];S ꧆O yqn\#ꮡ[rZQGR2RY.&eV=0KZ ‡%>5uQ9q4Yk'УHZhtnkgrC4$1e{q&h|Mo-/c#i-lFv΋r[ȋ/ vZj]!&1ۭ^do 68'}Ex/v`Z %6zNAwL#BCU*~"1OEҡu\g ~s<׸}nd6%tΊĔ԰|-օz]Tcc0_ܝߨQt\<%aB4DŽYAꕧvQ[y<5:ךXbxL- 傥GruP-CH>XU̬//kտz>Kܯ%5Ѩ᧜pɷ-A/ C]n{B4;rܐs p&spr%ڏ,s;C<[ 2XT\|ׇFIpK 3L.t:i>gN8< uRThM.]q{Ik )㗺wmCwrqF+yeI>YF(&-p/x[9Ӹ [Xl qOu,/si9Zk;Xd,89u>'MãY9mBB\w^Úʢ[:+s^~BiS\.Rаu/}IщXpid<~jyյZ ySȣqs|JXm)I:Qto$nNè;׳ p+tۦW4;VTE$^ Xǣ>* hmW -bmEuF6J{ p~8|,ia3DeN+yJ]~2yFSR)qe<3~U%*K}]GWa$dᤷ H I.?SW6TT' I煇KEֻ9{:գ*rt[%&Mܸ8ヨ-+tQq㨉hp6 6 ZKk8%{u?2;$AwZXM/F$}.'˺] ZR@I"": g=%3r@/3%ύMK? N0z]pyR}y8a?C.ZEѻG9\Si|Hqqemxfv`p#NzekZqiN21#qQJy5&yl4YIS&еѿ|>8l9i/n䁨/Ki4NrǂqguUW|!N[q'_ڎ3흛' Y]h4ς4%? syF普.ts[{ˊRRc+ eZ6SJ:U'I4c+ɾ8xr"ެ h5wucK ; \a 7{ :uM'fKwq qr~8Sk3~øTX5_p5T88{\NpKX$>iyuQ5i/{/y^-էQ{anr~Gv_wh*xv)v 1d!!' n~ :8$25$*1W}*p)~,UQr[Ef9Xʖ[}7zhT|yqd7* uxI-T <$md c@t$&XLJ&"'5Ω(wN"녌-.tn{RsMp|)mDW,*i.S;uv21D%{ H.-8`dEsD,TJ| tloRx(I4VpVO/˗?eWh(l7>)O|@~>y r>cK`xG5WVuv^=UeJkjswSjYX?&k-\}q = ü]u/+h0G+OzƖ.吜6 tkǘ>[ju"ݼZP?G^ò5+P:8/1):.X;jqֶ]'ed~jV68G_(jn+.I>Ŕ|?k-^&.3r=3F  89ˎH.ˋMrk9=6'lZӞ}v"mUi*mӾ64 Y L]䔸[ ZI}#O춋SE/=K=/ݤޮW.8(VBp^GAX*5gۺb.]ٌ;;-ѵu5tme inuy Хk'u58/*I1ثQщAʭg<p C~p6,8O;̡c o>V93iIwYz1u Ier@FǠYc}-=Ty`$c->94:f4Qe>'A;o0Kygl6V5Wo#IS_ aqL\; ;qmm}{"'}:A3Gy&w'䏦Ө[HZcv# i眖\6Vw^sEPx,/Gy/sgN-֟ ye; dU0HK78U Z}<Zس%ɘIdwJ|`c4NRߓ}džյ ^Jε:tDo74`XUD2GKN.VUu Xi֢82ԓ]zI2EHsQZf 1}T|$ͧ [pGɓ`#WIA973 QUHZsJ2&y6iw*(d6G'dc[ut2U $8k𭥹RYfJ3 uiy<.AЖ8dKo+QY 5fkFO#?n\9E4{IIrX$48U=^FZCikXM]D7캚M\J^ݗ#qT6]']fCfm#:U1z{r 4Mg hs--o8+[tw|)/Ld(mcmVzk 5k4gVkpTAtcphEJO ^Ŗ>24 `z4 A NF6s6Z^Mcng,,Ց=_jKDje'+;]4X߿ZAFb9\sk*3I?e%cN[Ds%xN9Z:}7GƩ]QÑ;]Lyʁ,z\[텂\NJ& @>#s1.F2!+TGR~S$ 5.:/$ABɩ$x =*]kDE5еNrB` 1L2#U~Q,;U54:w6 MLE*\[kx~&M&fYnw#ֽ1YGU1Jm#8e-F™ۑxN`enbȦZQu{ٻC!-S[Nj0l!hOVT` N$H2 ui|0cLInp Kj<7sRC-CmȝԝFNT`C:kn!Z2ӊG2"Wm-R5@h8 Rk1:˃0{|QA|&~gJUӔ[xq{ryѹ%D\IΐLŤucd.s̯ FSg%88^yצsɶ[=$-|L}-A䚡QJv>ۦsvˉ~|oh^7^{u+wWQ|c4䵣]1Iadu1-/2D39Zg1dui)5LӫXԝݬam{؅]wQMSLj{e G ۩Qm9{C|=oN2Mmh3i*Υn9gwn,%x"^ښjVQ٣7GΌ8prdsr$dmخ=4CFaitJu(xL_k >:SRsy>g˯4jjRP{JUOCo}$]Gl4t'vSs1i$ ˎ*Uh}i{͆\4L-N0I P)S|MK-Xm<ڵ9B"#];;مup2rq-視Y#`d%oԇCIvXRҺ8zY8>Ŋ=wVTiG 4r×Z6B51k-9\XOUOөYO8qIlp2[mnLeᣞl 6QkSOk:rYk񶬐G%;\Lqh=+OUOϋHj,k75G,hUFlkg͚ăSC ^ 8ry|-&]al9ymfɌw.{X7olH49'rTik]̭ю(W'9xͯ-Js|1>(!i~Y1JX5ɞjJSbc柗z@m5PIT[vn;l7{vb4/gJz!?>uyٛkiPZR%yգG7Uq=l1E>'T>7 իi c(}\!͑9VU*g)?QKj2)g0iM~]K^$6q b\:K:Z=_Y蘒G4~yZ\M{g yR읤Uӫs.ϖb UUQWis1S"lEKr@cO2*uds|kǠs6 G_\"AMp9&No'>Q'F/E?wKWo(s[L{:L`ImÜ{g dY?}'z~'6 54GGk7$fw88 M.Nd'SJdܟvfÆ8\%ϙ]/W>"+*n Q#vEKɻmZ]0mYo1ZZ3Z]x.~Ԋ3[ʧk,#\Fui z4+ 5gԢ.H"ҺL$nQVt7&xH vYz(9ۣ9ϹLX ~jre`׀G= -9iV+swY xS ԛM#+XqMcaäO q`dsVydMsǡ)C<ߧ4i`hpܕ7r̜G+-'$()` M`9'NY{6CrsIsbiR۹Y t1e8ܓ" fvʴ!3maR"M]mOaww'`iy]Z 1lcc4lNDJK-.ӷ 80~2Ae{nX16214XƤʶ[I'wxggN%'JjI<>2RSݮzQѴmtW[uFI#Cq.13%arf=MdQkA+k!6UmG~Yo4wqY;4#쟈Y`;N0| 1sHaTA-yo%^R]Kي럡 : FIisGGiN7j[t Ў-fD{! |4uL<׃g2C`ַnV,2˜}NvdkOsIR˪` !@Ih=079$VJD D7Z\z 6hi@) sN-ezH8imh'$[*}=kiwO5&v჻a0y-XQ{iSRy.`w,lМ&Wjxc1ZȉkH?CwE#Fz,xMibY.xZi;jwyEWNCF L(99OvME*Y2N$TuQS&YuiE{G.nG[vZ#P m U?P$-&^ܣ]MM OlfZ&R;d%V=ÀG}eUeK̒AµS%K\vRZeNqU3n9id k^@$|ji-e`82E8IF:R7lUIќtSqpLu[6&RDLFl#Gx~;m`ʻl$ ''= 2bT9X:m \YNi N#,~B< eXgմI.;?5%Mg-lmGhLuRVUp\LAõsyv\I cqf mL:'-h.HqЬ\GQI q6͵|K]I\ۧI6e*|Oj~q-CIZe }31*_Y[[Fbdq\c% 79;9Pqt#+k}i카GR84='u41E% cZfkP  dϕcZw2i8-'l\]4=|TO7ծ-y3xd()'v88Uݒ8ʇζD2MM>S}iMZP3eyIc}N WVX>Rx~.-5Q. o۬6"0W]sJh{;mdZ0pqyZҧŚg^8r:-ω7slp|An8y)S­5ɝ)҄SY 6$X0{(2`|G'2T|n9ۢQ;VUu1sƇset)T|~'4]ʤ*Rɧwl62/ah۾}Pd[ ':sNYQ*3]Ƀ zB>rr=67.Qkh{Jbp{f<0Zy`z*bk//d59ج+ `cd4od zkc"r001xXq{h[8r$i?qM Io$=gcsqvk>d =/p[+a!Fu-C⽕7Xd7z,%ܣ̴lDz LstLo5D[Vstkۗ#:jf)\TZj4ys[aJU]k.j lQF~]G uSF#pv]#}U^źᤣ$mG4ڕyN,[QcKE56mu\2Y>nZغUŵ_̓O>'v#Eӏq_[kkfeH|  ~EE#9p$ vB/걏>avW0>5,|ߩv3kj+[)%=U<|SE>As4USvq3mUqTŶjr_|׵w,kBJe Q6w2?<Q( wU\+/*ius.Fz 'c㙹XRg0FIolmqC E$gϻ'iڬ*TJT)9ɩb1z?lh| $U0XEXCEKH"_HCG%[yX(+MH}6SYAU4/am㕟#佡ԭWc+ωn5.ԗG M]4wAKlK~s᥇P4,njpyGkKL^uT[Iԧ.xUȽqCnwѵ֚ N ފi:VG{ьeѵOb grT[q=,cB*Y;nUiɦm)kaI=|)b'璫\y2Fc4Ъ)ĒX~mtq:i | ݙצߟC}ϳuM[Gb7°M#¶\SH^MR냔(߬ Yiꩩ%5~_v'Q咩B1unc }Dim)K. a^KmU4r%Y=u^y$UΡ~=QcyYEfd./$nXE_IPJr7g{6v5N+-4y~|XNUUS1vqkt=v~ 3m6J6Ii)cq&`(q.*jMuQkNsyn9JƝK9B5fo[Sj=ޫV: ա 8\ss} -|3ʸ.d<͸{P;tSM/OQI^Y)5Ppl7w7H-uA X{f1Js4F@$Hz=+O%y5$Îx}{SH+̼o ,?rRmoudOb}wKeC--WتMP0 ?n1v4S˜o i[[a7%'pZU}Zlcu<&)$ѷ, +ZILg(ucM=8:[oc %G<7\e+c|-I[ qh7ÀCry g|W+V>5siesIſisagRK.2{Zou 5"o8\y[=|d2ψlr\ :/y3]AhnW:srx#yn3\KN4m6n81V##P 8$;,e(Ǜ1#3pnbљǑ9?'F.>xk)>oǛLT97 v109ޙcH|EwYpl͙lk Q\ @L_3rBr&m ;sz=ahiw6<cdb^ 'MT~P|IS-pӫU"q |Z~М%;IMJU9dŵ̶  UQ9oTc:o+k?'|jz+UM)aKiy<#SsvIQrRf'=K#Ӷ\pOBΦiqeUpOg{R9f O8M ʸ{,9)NJ4y{yw#?Ely6;yiVmyEWo^IT}Gf]÷ _X(#.264݇yUcwMM~JvEb.+ ۞ mDss\ 9 !*̹5i[nA#|K­W8R.}S?7oBZxdIpM3 ;(XewA] .L e=7:ac ##vHOu5;[{|5<$-^aSCPjI)EIK/G~"&"xbG{BH_'|j3X$Y+[ F `cIP{x=nUh^FZ;K|cȾmtVUT;~ #eTRp8Z%N4VKj[yU&Mx^鬷 ,r0VSdc *J{f[l[TyfިF>G5;.}k=Mg,vZ{*J 1ȟ&p:g:'湻`eQo ]k4v;/\*+VÎ8_ɷ[8hnJmmD"X'zÝ^}*ǪYfnY-ycuzd*r9*|06ۗ璓\)XFI+=\0qEIg7Zʋ_#+. dWpv.Otq7H$) C'OFcVa=wXA&(@P IM ^Jda#K<]N jv<ϊ8ڿPY vEߚ1=|-Jѹ'e*ΓE*%V[*h ;i27ʨ?x9[P:-ueYn DzE.9mmi_YP|CqQڈ5> *&Ə1j= V-m|"i};ϢTO+4Rt(wp$Lnk8~EB[ 'Cnv*L3JQyETn,t95\w+*Fh  T[QԶQSؠ:d7 t~c] Z,ZSqQ0_=548N<𜔏9m> JFЕj-C {Xg26- #7rэu9q'oUyL/JW>&ԏ呅7VExt~0)e9ϗL`}vjlCr) $m3]7we ~կCvpXKy`5.nsUN`ez7>u$;py)4q煦Q6\HQ=ݦs7lpo-aN|VS a]R FWkFଖ$֙jל9ܶ[#NRMzєc7'[|MQu< [FJi8'w$$q+ꪚ% +CN o1u YֵqA*ymel.OQm/#u9ӫ'NQqxisyG\IzG_lrpͺ- '|2TF1\50CKdrWֹ%5:rKN9;V:L$~M}9S=S[Bڗ“1rpG=vco4"{o3%4eF襩ce xZ*xb1 :ΖzbƓ5^ O s;0uZ6RғiLJYo|>g=/_ftw>'Mp:I$utN{%8c"lrLnt귴ݯLJ!aF9/a T;Ky:M}j*SnYpQR.gݨٵCmt<i(uwz? i:Aَ 0I5zj],F60ǤFR'>*VΌ)&%h\V%(b- >E%5oŊm&l̸V M8!tq%l|8o+=Uޢ:j& &q07'S*i% [mWW*+5Q۩j2tTrҒ$߂T}lf쉶 fvvW>5$5sf7$ FH3rc=&U:MJKz*(Z_Nڜ#'k))^Чs ~3p Gh aq]X%1eGt\*+㣯x):|'`dӡ_|xsZ *&>ӹ”v8{,i4u\2a 83EZݧ:A8_&K^=:m_n9gܿ6h[#hELLr8CaZN 8R.?@6<8ۥXOYʝ;ooٖSQk9x}6?)kxC,QUP`IUNȘm@ӷPA 9ꓺmVgOɟ캱խkՊ^W5%t揦|Mڏc:.W* J)SA3 XHtʘ <FVOz$aGSL&|mEsZ; {ϥJՃ}2~2)[t(%>\ꏴB¼3r~+Kp^b4QӺc,;!V5-s5N8UBJ!š}0{ХY_PSͿ.[׋/U M:c)ns!d G+ ĸOh Kji bN mww+k 9Hˢy.i=tSGd┣>We1Àg_8:ekxm} 7'(=g |8Zm|J槌5c-pܰK,;%j"2@dKr>J݁j8$Rċq*ZHd `IhB(@<2 {!Hm!dAV:X#5ΕjwlXꈝ['&^~!u+J]$mpl;#m5iZXKMTYJ0d sv%Ǘ+;uxdi`iV%$׶jU +ht@u:@WF }QmB8o%C'ݝ桺mw*^<ߨ*Ƅ\Aâ4 MUZ=H$+g rW̬A&)!20l*S>G~'ܫ4MEjԍ(9˒$S {/:y?:rO5(. j(y\וYu=&Ҳ8g Dm+oSۀ7yF-yR|#ͪN/(Qtp{p󗳗Wx%ƹ3-pމq [?Wz2j-{CG_uV9ncqg;24yl.Pdaj(r^ܬ%.H.fA$5BK'f6%+."V3=!Bڂ㝾G.un]n:s\?W]mKM<ۻ|0xu0Ð0F'8 N*q䍮x-guk7^Vw*$eڗ+I/7-O1D׼ 'M[IH|ʹKOo{}眸l?/\QGtϻO0DpܻVZ_S>T-׌–}ގ:rfxmSq F9V!Bʗ<ͩkW+P$TNI2nniڕ4T*\<Ք[ˑ`˥=L9;%hs$diwVEVTh"]*mS$t.}O\m{ P_.H 9lDeˋmpK9v2#-2,YYYlk-iwFQ ash' Shצ!5;Ԋس!L'̬}|4)/k?G|#^1B'=94D7~veW$c*jl؄FI v`0%a7=8Yn\--ZF;nڱ6Ӿ3d!d Q&8Fȡ|`yaNu `@S#TIU8+y,zrmpjp{Ne^WSi7欘5059t4:xqU\;[zS,3.7TRP م-B]*E Ll|ӁZjfcho+-ɦvNV[tOӖS4t?7k'զ3;5ά0v;1QǒH\uu8nEnEeh?XƼr#+EHJK5Wy}MmYs^[<aq`ܵFڦ2Ԛ,=`+ =O(F\_c:(.1q67t ӞrϮbmuA8P⌗ۚ?|G[g^e'cii'<@;/#Kq#lT^grz}yۘxio^mZ'ПԸt)Hr '؅l,-Q$\9\ǝ4F{hTj\\2\ךωWa/ibohW;&[F1 ~Hp Ssr/ukzB[8K>ona {Sp^QY^3\8SmI]JMWi}u7gl2:R;bvKRMϦE} w|w_U&Ӟ_Œ'J G?pE+ASJ-5U1w [EcϨ ]Y#wm8g8th.jIPF1S߫IOeOgg$ 4˪ ^6i)<鎞k'c~V2>fՒϥѶrwutꕡWpgp'ƿH*6ʳOluH*V^+.-2UR>A[!ig<pN-mjpZ^h-S]BtB5tkl 5vZM79$q;~D*\Aτ!u5Tɛs$ume)fݱm\vƽ:1QI>Gfot6ۭDS\QQ'(tcoRUx)uMڭFҒQb㕗ʻr_h%]sz>"_m%Օjc3*ڸϋQpS, 09svU$kv|˵-Μf[/ L74ROI]_ $6茓CAm_0P^VmRշ߬Y_Ze Y,za~(8+/_8x[EaKqi-wGd;ry3 gبXN[<3j| xd|SBG?]ʟ`MwQ]igYk]UR_I~w\FQĜ;T *mTU25H"ZP$]_5sH.dd," ocL|?@"=SPy! @]$y d2- 6`H3Ķdd8#HY0hVJR=')TPA!7FP~89i.sj\MjdֳAܱǒUGL̶#8j |NOϩq2U]4Ӿ_Q]Qleg^ yթ&pJk8q|cV[7ùm'bp E@&9C`C  jURu4:E/hqRYtZy`@l YBϤ-Oj@d5 ǻs25j%a#SD38imc-'pyaL#J]gCX3`#>(8:j8n<+Z: 4TVO("FwPF=S-Aa#'M$/sqܜ_;"A\Bp8gasϓA+[jL*f'83w5Jqb2,m̒=FO KvwGf9>(YQ J̑%ќrk/r+`c1m;Cus|Xf9UZ50 ”>YإݾYF"rLQU.'?68ԓO,3dqO@<)4~6cHljn|8Ujb>CK%.^&Ѩ*m4QFK[9kKˏ a_ 4I.6i8LiILj: 1*Rr<;2Q;u5#d78'G'܈d wwb{YaK8~..]-7UU3TK/JlDT96N6Tu-nn1~J84BN;# iq.kdapkvIN9D6=HO;.BAz;)G/i-f$z/gbyM+ģNlϤ3ߤtg,pUuyC^9,v-IǗ3WmT8L;?zEmDGNg>iB5%IEx}NxX'',n/mmcqQGդLEINv J% :|{ڻ=#[zM7Aoqmtbj|dr?aD<<-"/ũڝRXQ^3,mUۊ_ Tc3Wk&;57Ti=97S[י&:^)u7I*#1IU0æsPp}Ihԥ.*uBK8ª[騭1taj8$T_ի'R*K^׼jf {RUDFRѤ;cї'27j퀷E.bbBYAߢɮJ-jq-+3$C 2v@nPr;-9ǡVR$nOd7Z +/ݳ-FΤZ4c?wj[c^9 j8%j~F*瑾4zq,48w?>r%֣ IzF05?ë@fena;XO b&|߹ZorzuYo;LsT ^YsBRoprzY0q8@[-k 29vnz,v\#4֊b8^w4n]cq[ݏGMJy+[WTS(~sjj,zZ,cЪvdD?W!IKSR>OboO}Jʞ&cr\ah11 ʤGX5[$&WS}UIoh'7EH,HPSv-z+x},N'ӱs̩Tn?]*ISᔠqh*-Y)q92f vJqX~5RqRėa{ I[n1s-aSLL.zZ2wQI§ًm&nmu'-=VqEjMh {ʪxwK{xI3:km/CtURS}Qe}y,=R>һGk<7tNQ@y0CDc1d~+C/en|Pu=de &Cz-,n"X~c PwTz\y-sƑNȓN  MGYN?ŏ<58g̵NxR></}aYnWO {* 43gKU)5JO0+MgW^|iEXĒdצ4M#sj8މ.qjSEi.{\ycRδkUIKS_vhzUgmkR~5rͼOKB$ovh#l&zZ =Xi^rR=rsBfgk$}S \jMCZ-\TFRD?g'oC:OG''9Q* v7SO7?ٴinvY[%hGk]Q}[NX|Tiap]?)mtr& }q ښ88ˇ%p5:zw+ܪ۵Im|֝ԡJWMU?]<&H8bFgcs\4kBJ6ՒYia7OCj7CEe_fR-7sZ pK鵕 rIr>3L_iK7k+=#$u1% z~:vJU?5 ::]hxx>Ó=wtp\ܮ)&ipN9/MkZR\b8K??+kU!rivXn|Ry< CNȸQj3!Ad}oG8|{a2C=NN q\ԁߖT<##c@ǚ``($S@$  H@@@@4 59RAF=PH`$ Fm079 "@E@ Y{È'(NV]Cy:82qI t(FM'km}E-;r꫶Ϣ,8Wiꤌl#mA8,0>H`li%hhel9O+ԭN T269mJ+d ]FꬽzuTL>y}7[.چJ8%ǑUɥkVyugjx(E*w6Y6cm*jZd㓓ΤA.Xq9hkr=V=,ά>efpB#}dLY̖5Nk DgXw5֨t\{=-ɮԆGq8T'9}<9MJkU3oy0?0l>Wf rہ4Poީ6H2ǂ@#ZXEte²h 2mld1ZKN%(/{="U6VI)L~Sť+~9Hʥ]q} ,f7S`zg9ߺ/,cy]%r~Y5[ф͸ICnM-tiգ'YzuУds/?/%%ܐ Y%r Q}uA-j4UI^BvU޵].iAy,l G&a0Fa 0Jţ[ȵg=Q3R2'%GsxcZOE$L 9VpH3C|kdug0"]NÎF(NfyF5)YV_#UI p~:P%g XJ1cQxF 3])#oS]úXq2;+KNQl0ֆ,,{=[ψz3Ft$чz) MP8$'<[&\2+6#ǁ=r)ɨ3hC%/ceJ歫"K#}OeYd-;sZ']SRi7YwēiOko]WV裪p^N1 Ycxɔm;B]%ƢOǮlhl5!c4aZ\[PӊKtn${Xgsr.uwF=`ւIЩif#()E07D״Û\0B>Wm`R+,, H]jyέkyRdi4p4vn.!J(qܧ\JQĖ|΋Mó~ pĕEeD)䭤%E,5җaݖ*jE̪}%S̯>]@Ӻ)r[,-:Ze>Z۶ۓg/oǕL% [ *r44!n@܁wU99[ZK(宾>{#d㏺c[$Y;zީoBsEM#PŸ @K!oT& Np}QbF!FWR&5N޾%&;ӴR~Mu璊+Xʇ 1=v:(մd%0y j4ۍ:^urKP֞z>:s1lj¦N0rcj'?$EjJ˹}jLogmV':iŤ͢pXVFv,k>`(57I*BW;RC-stwa#9郕յQW*ptVT_ӝM1M57/< ;vEb|6VMC*pc5. Plv.t[{٨FT` 總ܹ$"+Ϲt6hfFȌٗ!-8ԪYIG+|?,ƒҴթa*[8ӊ5!UAXˌ׳~1ٽOjfM-{vMY3n4bZ i##G.Α{V 5/vg^w/޺&ږyqM|. =\,Ge]My$wrŌ%^4FOUlOPcÿPk:*j^-oiG5b:)l5g?W٭炮ݝYvM-umE4 1h5ǹoW.fu]> mF2O1{,]ǼKE4Rp3]>{p`P U]Xi+\=ӻ|SRBKkY6]+yJRI<>Ot|pR¤+Q\%柊:^ TxYIGCplCSOHiu;~+u%sOv )'KM)PFqNIɯPTTqgҗ== 5^t&%B 0uZxtTg$)]Hp1wˋ_s7z뫊Qu`J1q]q_gEo'+T(@ uyǕT 9 DuBFp@1%4B(@@HArPdae$$꤁l%sXVHcqIЎb~$¢Q`чy%*'w}Qi's< gxHrZeN9GuVQ3n#qvǑ=NɁ%O&]PI9uiQ/tG:8~}/ʲj rIpTDuNUuh 睹V]K'*i)l΢O@?:rw۪TeߞJ;vx{E|% n Vs\a\"M[p<7LqY)c[ۭQ^iΞEiZU8ﻷڒ\#R2'8RYS7k02<Ic-;<-e >UeCgJZ1~A]CtTH1Bu7= =*/j{E۵ZװPR7ԧ%m f4elT;[]*w'y2WsodˁzYew=xȃUd)X,>')i82EGcXϡPqLP=8| nqSq <86XXfpd@F2vON4GRJ0HT7jQU>G+G}`}e8D]VqsvWTxth k#0ѱ>xӺҞO-.ARRdz}]+tI.Zp[x7qT.+2X!t wp𥺉et7Xn#Kk?n|QznD1^=-ح"'_W񽍑,(,R_ ^]+fۏF,,c6~ʴ _Sip`x>+**񆽰xsH |t[ԒESmULl`8VV\E3F9]) '; eeEG 3۞xrμ ]:V{[&]9; n#o <)NxP=|sPup^\6vwcZs$2>sjMVqT$u։m;a3c!튶'MA:PrcycFmq9 nW%nzSSȋg>W:ҏ)]'ԿsnzKopVZZ>jd򙾥8UD}O%<79s>G#o:-y+KJˤR-_9t H$_sRjÚ~W7|Tb5#<~ tT._q1M%9!-❭I:Qϟpjui?x++> {X`g3pZ3X$m憑F3+otp57}5jFMyĖdvGdY" OO8k,L|#{DD@~N2ưӖ'?&wyNHBx]oθqkĝč麄l%dBHIl|]u7נoW\F^ϘMԭ;+x՚Ͻ7ɾG'|0j'I,dݳ@hׇL68viSGG6Qk/]-W+RǴϜhZٸMz.⊗nޫIœGE%ɴ@]L)'5XU;摁ӰG)'-c:tjʝ)qEr|~Ү^ӹIe'G\An^khj:CU:4w}>j+A8$+4*ԣS_ k_h=e7jX4BZ}@>tUZ]K!x+>˹wyRJvǣeЬ#evnqiG =ҮglЮU5:*:1̔T6 Q(W1}y+V"] gK8VTK^\ܴwUTeJ+shtI6xNԌeWIV 13$Q}Fݓ!#74Ggcb Z%q[9ƩSE3uTlkkcfUfh{i%gAyMlke<8qߑqZ񰹹#)~PNb s]K0|% G=9,$y`v~IILVyIuKI_m7L/8,}'b9-0eǍaS F깻#cp0?V\<>;_יѓnsJwʴ_ bύG>D2GGqaRIJ=YQ| +C0ϻIT-xLgsO?BxݥensrF{RM/hT/eW`9o 9$8<yQ"9|AV;d4z* :m=:RdU%eEm8XNvuo2en7=~MS|fL],rՍVX {GvI?F(C>KEtzUhTĺh|==*i;Z\p2]HK;Oe7T[]GS,2]RjF?<4gH GQ?e,M&IUw ?zTp=˵%a\U;22Bnrg9vǐQfxh+bfT}L!Of]Yt -Ž^SQOl価TA|B3GVS03ۻeЩB:1ekcR/k](QKn|Y래:vo`:ZɯOO4SNvꬢt0K$ڏ2mn)pusE[MIe8lq |tLy9#rYc8,e[[vet-yVı "Eq,2iY+sVq$`3#)ioA46|UXBgku)ޑСc^"i#[UWNcU;JY**xd>ed 1NL=:*?'U;:z-jK,-Ak!cQ1.Oy:1 kCҽ&;(4ҸӳQI;2r+%ʞ8d hhӆvUs:NiP!"((M;UpI!Oڄοyr'r\in[(YF‹OKl,}q]eۉ+]ȩFi-$j#6;乚Ni,(-,~Ke7+Җ| m+=~|_[!c5nOO=ʌj8V%|҇Cl:ӂ=WVhw]W ~GاٹV;z٪5W]$UY6A0KrSg_#^b~'M4aUdHd3$xk[ x-vp1ֺtta䥌qegok ?"oYtq/:9 =_lhQ%4D?Xޫ]%;|1l-3۟!WFSĒMlKŲ ]rf4Y?0%s,djoፑ8EJ*n\yZQ}|j'ɥV y8zv2iZf2ROp;$Fk;$a4Io],.3F3jVOelJ{⮍܍ڨ9nKahkGyol6ZFQ( ^g2#.DY7>jU,q<J6.\ÎS)ҌxӔG$qK~.G^] f$lH"%M{iO3½oܗX*Z9RPB[$Qxvi|RدHOkIͿd#=(%0p6;V*RԪEf+#Ӻ~Jʻp>[47,ཥmw~T+5Dpu.$} @>ixl26YI1B!e@@@@@ ryl Yg&8F => sǀ2`zגy"k,zAh,}(/ڷA,EDnp+SH7`*0yۨNpq=vu'Ok]Z.<Vҫ^A݌Hra ?Ri3\өKd\Z=*g5ڤ;58- `(fY5uMd2|89w:WRеIw\Y$hJt%7(;Ӯ@N#}rN=SdtOK \H(kbpC "9Yɶuնi8"[y]UΜv mh#ѿPve(g<=[R5pUI$캴4oF<qCeBtkԝfVٽمmDߪGp5#q:EXM{ĥC*a.$ABR;+z}UxvK{]bYRx{H*:{#qWhFH7*Oj=1xIUe<̕g9Ue%$U<'v=qǻOUC+O vQ7l3\D/8\Zy<|\_/KcHpv겜8ȿIik 'W8SA>jܩ3=AѴ`KH;Y4X7tX  4/rR' mߢWhWR:ҏ5m]:mtHLzw` QQKbw#Ket']#rͥSsryl1H7>Fgali0[r }/Zc+d+wϚߺuzpعi_y-›4WO[L`#G^'_߷CJOٗ3$$`>d'YJJ^+^T:UB:zJKGʫs7`mשV<\{)5\*s\8sMr|9kFO'4;[k-ýsZQ\%N ϖy5ZӥaIYQm&'k~3Qpya=6F1:t 8Ddd$cy):SmXo+,VTq6ilR61I1D<3>FtI/ TmQ !DwO>|$+ %.ukF7#G\O0]ͿsI6 Mb+_yM--ͮ?|Oc/C\V}Zx2<#c[(8,%۸$*w^+dra/p?vڀn1;:l'W8q7dz&UNкΥ'MrxSsXKڋdgݡGOڷbOvsi.)&$vWMw5O#_YVF30\al-xk =}WjUQҨd=.F愸,a{eUoutsS p(uHzmEJ9zjp4X;n.42pq!?^yBh^[v{NGQ+jcH6Ӄo)W pJI7ЕIM+׶7.tv v3WUj6q5%82u»ƲKqN xګ_ҕ oGZч Vq-s#%mED큍 ظ`溴t{I^I){-9iӍiRJ_³إe, qHIX{n.tn{ָ5ڋ@'I?Elsd\j)b;Si)F/0kwkqRvMğhRXTħ}Ws{2T: MO8o.ks85J٢p# Ўk8 ƤZk{4}NNgFJQ{O#QMC[O#7G$Ok- 3bX5gc3NI%qJWe> &)+ V"5,RxIAVoo,{?v׻oR>FX Y{M7 Sj.JW繣X:NU>O-хFLC%sAi>kSY#cmg0PIx>RGͭUy~4lZx]$T̯:ea6cNVI˻Y[kXZڜ8\b׎yK3|qf(]!F>Xew<."H( fp zT֧u+kJҢRRYeo⹝gpS]S!j)o#4ApW\pѕ䏱bN79B@tLy.hP4dyYg#0Ӎw#nDH:bf:dvz,$/D4rK\Vf 91ЌXS+:I|I+"c:U6$u:Z̩V%EXxtM~S赺Sبsq.)81w]3i%^i (.PE}k⨓]NуcpHn4O$n8XHYtu,yD,ykmExs;$GmH@򑨬I&tם!ap8#Bb8~ˎ1Eo%jN)'IeD;elc#O"1y~]0,l,CS?hP᠞ySgx ߚ 'VDGۃ"#l) I gJ\D0ОEi$/du%l[4ҋrSyTDxQm:3r*TQ) YS[ `ae)yAUkёm;̹Yg'z;sǘU51:΃a3۸cGP'dOjӑd8F8!bJIrE:rBLӍC@gͯq }2qɮTܞ0>]5 z%V>lѱWdlW{҂OIj+{<;>{gXUEm=6u+ʌIa9ǁe%DTO,×w_cF_I ]5w{58rMW5:Mњq(?GɑnoմSԂX:K 0n ƵUS4]F991ʯM$ls91o %U&䃷.K:Oy<>PH@5W|vU9VMU>Uhjӎa\r"H0cnW{KMe%n{AyT*T= bzi+|2>)G*5NWǸ@s]MBSO\k/gs8ezjKc%湝qüQHb[_M]su&M;c{eys!;6Ȱ w}|}i:\ǂ F3dKA܂q, cߙ\qФΤr +GS E1#eW;*%"nT y..)s8B% 3G'5ϓ%N*]В!_O9,Mga..v+G'?NS\.y|XsU&|V^ێ)*=SX,{CWO/sh Ǎ,nGUhB۬ [Oh/cկkWz_d/vnzcY iI_yi3Frh' tv{eo:0X[g;V*TUu$7#ۃmvhx~Vy8]!.Ü IƬd(=L-)$̪NDh7(.^-&Ok1k=VD 9`sMzU+Ek/QB%h\)h;;H.jjZ,/nǴ9b *ҒMu[3:tǂi45s7 et5tu3V@"4 h4GCZ.}Rẕ'ͷf `h.5wyfgQS!Iy9Ē}IZ sYЍS4䱩rB0"F:sV,0 Xӌ?yNP,$kb5}]CYްHx->'wP*c sXL 5A%aIN#rVr--1*ԸwY\"VTҸy]xw/sEW\QuV))/'a td uKXB YdwlEK1;\XyXnO5WSث%EK!RMEiI x,Ni@䇯\"(L-^&srJRlu7#< mZ1QTZ5;h*ƭXKn*|/2^k?z7H.:49. юd 5z ='c~yR>a@BhP8<){.+S,|UGGiA4G2gCC|y?.x3f<IhvVrらR^GgwqEښMgcMwsB=1]mv܊e68F:Bm'GWxj*$o#X&ǩ[ylm|كiَ6>{]~ӷ<öPpXJS,x0ֵ"yWS[3`{Cry`5T's굿tᕹGW eV\|/'pkCm#uwV\cS8&FN1dnAE38 6z-"7졬㊙2!hk 0 n|ϛ:R"KQz'\ǐIie6IH28>kj#IGyƕ8JSRrrώ *uI-5(x';-[;ONoeE7Cu"UeꝄWx[[|w`ڝzu&EOx VMrLB8irxRQYooᑰFJϙPdc-s ,̆gǻ>뼹Y3o㜂UH)Eu8\e\;pjqqE)8syry [}}ϑ&5)}գ[OAœ+׍Lc^ cCAf^M-u#OYÚ1|>6^Nk qEG+PYMv%Ϣ2E<QY7i_x*Q |;J[Q4o)i'H$69 j(o,Ky*TT^^[u:8 )~>6%tMΘْtdaGWi92|6JU; ]m;)uFr7]ǔq}-cM{i_-$:1>r=ˆVRW#I孜F+@!g o>^Pmo-ż:3ճ+z. _5N˶N }ogT*M%W>yCOKݧvBu='CVt934cSy"&5d+gY9G)NOUeew5rF2,(5U;̵o l᤿Q#nzWv.`MG\*9aIlm:),,e?3Ku*&鉲8gTM>jYUeFTLt#O9pZ%GT4Mr9x=4qa G``\*=QkR74e][ wvpA8JMR%gS5WA<| -r17>kg[]ϒ =l9uY$rYeA"@$  e@B>@WUw2|ոSFMn5*9čWqi;,qad~b~jy3b R$d1ǦH0+kLftP:_ulOJnqdhj@wmkk (JwBԊzCKNWiDr:F-vqalbϝ]JX>f+jk[-+yi!型%$ cFH;PmSmwρ-‚ 8tS53SZI#w/@j&E!`xQqࢣ#ЯPq.m&6HDJ7Ʊ40\3ɽ򺳆ꙏ\xy.TڤTndzٮtku1ɓ#Du*|dvQ<>wc*J]T<&jq4ȪEI\y{ f-ܽ_5DI#NIZQg*f ȝqHJ>8Cy Ut0*MT̹bZ$ yy鐯==Bg[`-Ȍ *hՃ85)Jq#p*zX{$~[>{{:p5VYisG㌱QR#o2:ʃO8__<*f}${\[,҂Ue>l %=8T,a,dl V-?y#Cy9Udw$BkYm^6G ?9p@cX*ohldM.k7;%c[Aݹ *U!J/TIS%C2g0$xU[Q|ή34*gÏW3=vJVTv𪺦[EyGϺ y@,(OeDK"驏s:pW`tzq\p,$vKCx1 ï?:WxgPH p@U w C<7ulBUl +h ʥR [2Cqk|U.F*=ɞ6s(K_TWp}tc⎾h]=J'&rkY|c<*1mʵmwww[s];BbWo\(4\Uh:!qfF ;SZK|K*C@qZ0Fr6wz'jQ׃ n>蚖o`l|m(aUy|[Ct벥{df%y馦Miwﶢ'yl6(UTV);))%j <֋,%ǎxHhBC#0PxF 9(@4Hy~Iՠ*Tx.-5+7ȭPis%lmO]xˉf<֙YOKY`-v; R|w{.үk.U5Sq cnnާ7+mIe\ri9Z]7h^ɡcYyX̌+=ܑn..;u8H-yY&}V CtJCs`.vc>e}x`SwBE#8hILN `%6\m7[iHƂ*uCM;Dm!lӷRVR|K&tkh-՞an0ñʹ f (8>Fo< PiDKRSG9ckh-ՄTET{e I%p$eSK T.v\.󋇩CzOqt sKUC$NcH[)F{:5N99,>MWݝ$n9mETcc;8妌kZNW-Ukn>;FM8!Qx#}6Xɖw1 y]|͐=X];}BmV<:w#ߚ.f5 4`nS:QqKc˯WZ-hOn, nY[*k#SJׇn%k0UI<5PlNǮߨ\Dg+gP a$ceQk}ioN }R2IO4i0FruNfKzcVjPv/x#xw_{/)1O3"KHVU7ē-9G)m@w`Ce|tC.L:TF;Å)aS g%T6NoQnGMzq5e؏s|.8hՎd=:x,I8rJ IkAv 7)>[(iˉ@ut\8.ab7Fe)wiiӔd)Y+ o٩-1@\\%+)7'~֍2џ6VDqǥR c'RRr_9e/­'dtYI.N,aԪ sOr>%̳cDnxAVYn0W8 jf tx8twֲzwLso?=cqk $_4u##ؤpPlvaldu­W;:rݲ{Qe4-LowU|\wK9\at-<.{k^U 'SD^GGj{T kMggnE8Y1I겜p꺍LsX8ߢKEL}8Zr0vFk(\\bYV΍5=Hq ,l` *I%$e.DرNW2qR_ qKoE_^vgY7ʚ^c5ϑ>Uya^+qȯl7^4ϟ^E::zg^G6zA#/Z-.4㯞U,rܻHcƟs=<~.u5mRFq$ WZ҅8Nx;i'i/ɳ9wM.M2<'E\?kEtw`tA+;thǗ5IP3% W=_rGvkinm%)5h T(B\-\5IP$-k Fd5BGiKrܜ6z{U p\+)cxly"Otonye)sǃzj]kM7IIemKYC[\K\wDz01gf\J#TWϓUg^ջڏ[KmY 1'`i)am7V1 XHvH7l+k7wwo:m{57c*F8~2i%z%,YYuvKL5K1D׹$sg\(!Y${^i>X#;A-Z5'°9t^>{;'= (FI-o _[kS=q v]YTmS-cݙ2n2wV|W^b=9i1LXGUe#1/Y<^%Oن?s+rм{pJL"3 nWj/($ttW~Ĝg+TzIj:NݳcJ󡖘f$|^+KE]- S|mCYO=ʫo U*(֗ _\geSk9m|+w|)AhߩioYlvIlhYcwA.890j%&T5Z^d1덉_︣[5 kϫF%:M9|au+To HXˇx:B 8/ˀ8;*kYd u#3eQ*H_Җ疹q-bv>J3t[*epj$OD,%>mQ$OG88$ة)`ȵ G%*&uӞ]Uͣa90BJsײIkx̡D;CC¸+ې"TTq)AfR`WEPYE&S&+汻.v7m.`Y(1dGZUߩ+52lVkؑClm>7/5UZڇ`4,%]w<rZH'3.-JFݹu\7nql-=pk'HnG=H`ny[Дua4bdcYDw0O?ufXy,@8HD`.qɕXbV4x \=[i51\Iye53ujzfaok y3LN˩Q4q,xCOoeLTNsǠsUW.4dYu}V.K'TdڦWJ6L5ûL3j8W=\F4zly/kMOb5e46jy]:9\r9 *.8q%SN*j%K<òKZb#hdyep5Ēyl4=px:HKֆ;0)᠃Va)kGXtls1tc9DeW?vAOoKۚpU{II5ѯ^6T4CcU֎8sj\o([ӡx၍ic2|.0gUnSEJ!+`d3S|Th# rvS8Dύ9P.i4t ZFU.lMK,q\r^cH֒s>(XˆQ.o4rUpKFqvdoU .sDmˊEmB֧U|]Hæ-OwLk7ڢ9h-1\M꼥m8!sΉX4rX9`܁I r{?Ю=S3gU6'E~qOU K[C|U96qQDeQz8 ;yQ,5m?yˑr|.BсUoϺn-QE j:SIC" )8)EIu^t(s.-u_(HV['FNW0DXrxHoz bU#сkE-Ef) ⊛yaԸnQχg{k)R,98h5EK`u8k""d, Zil矚6j4E3vJ;GZRg nq̭Dh趧r]Y:7x[F'R656#cJL gQSo]P[V428;ȸw=֓Y чlBP|'MY19=?*Zd_(oEHȜ4OmޚPhzquqCa󰢣@~ar5]pK-0EL3`1JF\aeG>? * P_:GA.ck}c}3IIQ|Bۘȱ qlji$+K$q/9s&ج2=qYBpXgVebˆvp=VIXB[ .b̶4YY.,5▩%%Q-S5wʩ)6)a26 ߦV48w*"sNwJ9#-!Gӹ4 M9 coe3JItg#f-'1Y[qM5mB#λUJ c anv9WtQ dXp[aRKdvtn)u"Civ]q5vInZԜ8`M'P]uyY1> 5\*g8Fd7R)b)Z/8\jjS6K@?lc |͵'Ila{1.ߙYce]O,&6f1 Hg Dq'V-#dlw~⫹wkrUPQ=ëUSJʅ/v(8Sѻ+xi#ak}*6]I.ELRJr̕p,F:CuO'WF+ V`kK#>LW##<(gȿyyBI=p|N>|b%xZ&{' oSh:or:NlkIߚܐt2xv!|곑$MNGRiwF D`0˛9lelɈ$>] KWʩ#{RׁT'W\'ŵhN\pg*wnϩK-#utUb8jn 5-%ȃ'8v%%: k% 8cc8ps1O! =qeFG{'lj$.*3c UKB(U?VupGᓛ=/oV+?;Wղ^+9!eBGnO2\Džu ̿0\iv4 \H7w$sg5u :g?Cm0@ e#_3-ow;d'.lݸrݯ6d-1|aT5 f~/+,.)_yc4㒻l<]UfĴoPwS8 it,V.*itM5CO ̞hH?ح srJΔͺt9,m'0=\_KŃ#Ү99$w/] >elDi|K $7g[a--yBL,>OgʭkU 7F0QijzxG"GMjմj^TM<:>[QN%ǩoOcNͩ^/wxY~.8.;[@iӲ5ť)I'KT2=Hd%'rU{ 1dѱE1C1\R3)]+~U|%nnQ幮D!ߒ;fXpYsUf&PFP+Q fo|/ atcHwhUW!iWhmG-->e%[## ehM)9mJ$*P*3-w`Z46Zn賎ۘIe` ,-4Z5tYUzU4;*#WV'XQ$[T ;0%\n|R< 4ʐ ZTǙ >as >GNuG\QPq](=9v2IUǐKr2<IɌCj!\+J-4Ҷӌyx2p52c~RR\MBANß%B#yH3󒪸O^4kÖ0ZHhչԷ~2=^xpqMWXC+㎶Rh8q! p  ~<mh?tc1iTЦ?TwK>~|oЯ\cRߞL -N޹Udžחqm R=̺$Sln;1"O;|k?5&2OqVN韛y+BM椛T& [ue-|fz7 >&5`ERHυ˙A#䬸Y#%+LPDZnZI[^Gh .WTbRcq&Ρ5IeK}TrHت $2k>["(MΊ_9흢 {Dg%jC+!9(э+oilU)#ƱGK3𦊘ĘזEuMeW: [1%oKTFqKe=J6hJp Q;c{!hnVzx)K'7PГEQ \2 5uL0DUN3r<ZOlVrJӾ9T>U{Q~W}ԗ.Ү+r.凄$t=,d[ܝNz٥FퟩXp6 &4g6?O],/K$9!>e'ܫ#Dַ'FEҢGqGުI HqwZZ`H0qvZR9WäCU.#ws>2u0٣p^5 Tn6zmC#0gIHce*V;$uJQ B.KVvYvk.Ӷ:gR:65jn<#a zX#8V inAVI\'y5O\vYN Mp,kFInT,ci1<2y;0I.sz#e-'mM2HAz-rTĸW2I\g(]^E e's6ZY gs[)4͑䑜2tj҄Ҝ# nHUۚ,sV=ZF{Iv{S;$y(2*q9:~$R=ef?5.fpeV,u{ij~EeB!sZ_J·V&>鬔5q*,ՠƵy'д'_Jv着!^M0&=yY_UҤ49w>yIxx#q_.8z ҤPlmM' i*Ua ~jfv%(=l5 sȬx /M|,6Cz[)(Ir'v$|WW_l{se %&2ϠR𣂫4z^ۘYIzu^jT}.L+^S!*T*wVYуpDQsc3ѻׂۤ5V0L:Қe?RavIˎEt,ʂLH kt^9;Xag&mn;(1[i{2Il\Ռ1 u/Ϛ#I' OR<iufDi\~뛑UE":t.մ ,HG <>y3{Zg ]Jr\êRh(b[]o)%h~ʢ W{S@a~?2k%Fa.r^hy쳇4C6Bq#},.T:VJ6quEqlj>׳?3sT5y4R*xqNrIHQvt"V9o-Țg5ψëFBMǞ rwl':-ŕg~'AIV& -%8sNn0TV3n];LFJZ4%yBJoQ^?okIi.rqR'B]ުx=-iVv)ֱmΜqکOou<. ,a;!Ssm}{S5OvKyU*mޣQIiǬ|y5%dEMt |pw 㜐^@ՖX#p8f[E,7maLSsWJq2@ẁ^pn#[L`URuWbke'j~XWY٘]m5l?&1>f$UK)]Qq [l Uv3*eg~!xÇUZhls,uosZO$壪G-e٭p9[R0r6G<ŲZ̑ 3 ^twK@h]|єļ8д[t)E r cil07# %gņN ZL8`cĬ 2k\#p֓Fqr 58rvR[N (۬n.'cde| eI魩nui*$ ϐW5=$3:G-nO8~Ov:K] tO>3em< eGL3-J&=c|ce %͙F$YkyqS`;Zn Msk<7+k8>xzy3q3d|+~A-u2RӍ9'|pms2kQFi[ seEтZ54u>Y[;?3K{38l׍ 8Iq>L7Iy Wu,;F8q<-2jψ 2T\UNb C<}1 Ƭc(;T? 35݂rR{SR[ϒZDnkZvViqUpRuZoD6qqnyU)~hVPҺ8LnRVx`[\/SMW[I$˜c+\_S#[3 .okΣX-R6I.t畮.v]갛w0ے2 ck#9|Iow>=8[ (}c cMpAs\>("z[l}MpF4Sy.iMm92t"Z ArhN[pWkAet"\Q;9pi6yltʃCҿ{r!ioh]\锌 boR7,n|M]/2=SߣC03G2osL$"Β=K;gu.rw^z^Ԋ&fp1!dys0m`+zs4CUFߔ -] #1VK4JpگWDAmvuGe"]Nw2 ll ]X(>5x ff> S-#]0ro@]MyNĺk=DQLgF2s]]Hjs8WS[ݥ.g_kk n?qlJ:~\I'u#VΆؚ?G(Z;J^K.'ooe !93.o/# ԐF{%kt,c{5u-dg6nm]+Mycj:ގ_iN7?htM/?BG?nv_VʈjGu#ܹ k|ԦG'fOWSU#7 c k=1q;+$sLPN| !gV h#9 hnmIs2ҧN Xwe5]IbFd{Yt9լi(P(=^>L\Q$U/W'\C+f;ܤ<5yE 9pg?y=mCQ=WKtJ i$[mˑ&2e\ W3wk. xEbGKkލUfM,|z}+V?-/Z.I)2NQ w\sĻ4R*KQ;?eMy_] |KQog'?0LeN,>7EoinfF0jq'j-s~(D3(qw8UgHÐ=uњnxlK4ש>H} zOP[nzVas<2볲F2Y\G77}CD< H\I. 8 FceSSm'%RUI)e'JRI9rdrRO7YJ8%(|W*I;hicb}LY |t8`g' U譺]dTӽ6vI nZӔ>^0,%újpѮ;j)78co6zVvwx{G-#, |ч$@Zi3GK -K[=Ac#^ ˙N(n랮n%u^HwjaxWy-i%g> E*iiH{7?Į.KJ!"N-#Rj2ֺHS:}{c)lob 9 |޻c%;QHD%XAA7]eALȝr8cWrk{9y0z V]jZ5$Rmy|Y]5ڹh$TK;文8I F2vhESPUWN>8|xgt] iqEaϞ97Y}MM}Cn4G21@2qchՒf)|\̟;y4q2By_^?Y[&QNjsd:i#&8ds6UD9p{o\- kkV2SЁܱ+p$%C!$loѫcːݗ+T1'Ziy6D^rV/@Y8>[3c+CmXBM.ycܜWT.y@V$$3 V^Z6=ȤHϚO'qϑW<\[Qx,-nysT149Ϫ鷅̂Ou+X@8HtXRDG8[H \`$+*gTj%z{*;Ӳ]Kiy*VYȯȱkfqfi<V% "Mv6e 2|NEVkFIqTN쬡.-_yJs+m^湷=RTv9 &9,cHNLX!1`l kG=rMy1UI6K+e9.<`fj眣YcMOJA)4$V/_Vm p`zy(,t{n}Q!V܂`NRTцp fjccdv>f_Ql WBmnmƴg"w~ct#dJ,lz@!ʰq }V2{ԤH$qĸZJx4ʹ:\}D%o>ls)iӤ9{+;I/%X{9(ήā(-ɩ^rRٜRu=#S #ΖVmr4Lτ0An<>Fi)JFxRWO>ʇcassvd>i"ɩ.F n4eyWQmKkUz\v]M:@Rw7|~T+lu7M}W5olJ\Vq8vrt?" yj|ՠq6{kWO3\zqg;mi$[[>k> 7PJtfor3-AԿKbeJ *XfRl[9<[)aȲKMNE X9Uq0=u^pT^%UmG8P+\\H+XN ':Q )у:(WgqT㙷J )ߴrrs k {.b -[o-O2eh `Ub2TK91ĵ8}jvr.nD⧈sNd=C7S~ݞ뜛wewȽ\U]Z[VG7tq5YN[#OS?#Itء=CFE 7 l$^% ?qwzPaƫfG(o7$"@;iEnll#*PrTO>M_um_ȢSGRWOEy+7jZau\- /3/?oK+8j(/4{ uB %}}ˑ&)뜗D΂䮻VKWrG=0}:ďe8iWBQ{-c.F6KW:63z?.u/莒gg\=Cҿc?IPrD9#0 N.j"Ouا'4~ʖ,.6//qhgGA; RIAs4]Aqa݃wݡy6{Sw3v+ ~G{)4C6G.bNgvbVgE=u Wm㑨O~XpoESQ4v_s꺵=ͤU7L2Y^VYs 5&+dioէ Iee-56%e*LY,ܴ;N *x xkg^VuyhѧBIb+d )g>C5L|;pk7R?K)zJy'z$? KKܖA]Z~4H=EhK~(ԧu'k yr#qv]^H溪Pk:|NTjM-'R2wႺ T *1{5t5۟MWK+"haØMpͪd}*'8:Y_Z?AKu[ n^M} 9r߲u6?_uЍW%7g>lnXF,JѠmAU[6+LD7<EiM+ m:IlM z(r8'8*V$x@PL> stream xPV_ "%*(R Hww<%%"vww+vߙ;syיYs{^j: 4TS NڟY5C5K5ڪqqi-+Ծ^v7 ψ?vje/c"5W>??3f "?ڊA;R[k?vWij;NfשBma {=|6oۗ}nn?.\Y).,W7ͫߜ/u޼"wZrJx6/88"dpնFN?@M?O_qZ uԷ=:OXV+֦jEyAݎejS?<߁pmEJzFn-ͫt4tX}KA!}-ʨa]qAH,X|pkvKxsD렭;llln .ǶvI;wzymY)M{| b/(>&::&>E7Ŵ O&':pݤ>&I9l%%3/+(;"'67)/=?X(x EekUwPdѺS4>|@̠0wn>d2 P 8IB6ФY-71g7Wɧ D%R+`ST6O.j[پý3+;tp𞑴Q}\6;93uȣϳ6λ ]H=V=.Z?xg4ϚxEK/_ym7vq]{>'fO}‹֗Wc޸5~#>}Eg_c+H+շ8٣E.__Iwէ)k w5]޺iYzO-f67otҷz^k^vvn;0p:]Jƺyoޱz7'v{ z7}~5$Gtk!(D7T#o|uc1 3qS ccN%KMM;~&r'9V.WrP!ZY\]1P$Z `+ֈ`d>\~[\rDFgO9; *>C/$"Y/IM*זVl`N.ARAh񗓺SGbkgs/-+[?թggϽCWWǮ]|sխͷwwG'YOÞ9=_Ë/^_W}Nݓc?9|V|Wַa?گߔ?Cm_YQvcr]ZZErusIzI[?]1,\gdhlݤ1$LyzE _6$ lݖc֢U6V.l#98wru^%~7;fGGg]^ۼw}˻O +CCpgie_?Z+_̏Oq_&k<|B.%ޥ{ˢS*+kym_|g?k@`?H< 7]._JIW?Vz1asy |@)<_XJ#drYIŗf+UhKY+mq.\o߭0~dx=eS#f-G[./wYJ99sg 9sQqkW^Sn~[o)[sr_ JI__^1_S5,pcԧ=]ljM۷o~<ߏlEJ/54=4hjcVE\г{?dZPZQ:uc&f̛חZxZްFVXYʲIlwԞ-QӸ3åx{;{wnw.O.?#׻ {> /D9k?'D1õcqĴݒ6ZuK˩2천优Ђ݅EśKJ 4~xZyB;D]kH P5͆ei t[1QA /PSXv m- WA\)F"?\l k)/?:uЛL =i4p,<14yYkQ,H8;u̖zs v nܿe=q_?}B~z ˻0߾[yS[_)hg_ƿ~:b̭sGڏ-OGC\6,.@z?AH7/!~.>O-z/GF`pgR8 wjh1XJx,ZhAs~7؋O]7Ϡ1WD fB`" 2NX ,ahYc'2o&Tk| u6c32\nyt8Lls 'd|%Cli>~Iol+$APB0B52k8@5orڠP{h+z*4D ,8E϶׏HTM!M#Hd> }uuӓuc׷BF)O@Գ{{aN:.&oH!2r*D  ~-i] lk ˌv:DZZxXzl .,hfHzX757u6N<X#A7fkW3^.{ mQ^tIM퇞9C ?<h/6|Edњ(20wGe",[aOn;`f0a_簾!tfzɬg8ݬ,>L$ ؆\@{Gvo-0{ncE^+\ͪhZb Xx!1kJxCnB~,]!93=ȠU?>4Q~Vr8G'}6cKv Tޓ(|E[dTt)ݨIDt4/k u.oYiQ6IU­DaWyBw9 ;bdf0zۆV Wڷ`mVÎȚau"MR(~Q3*jGsS%N~g5gj\ 7/ N]S3BanF-F"9}) l >(KZSrye66qnjt:qz_r"]wt$]tsG`LP+/8N-riF]X@coM K#;cJ nT{\ ݇y"T+Ƹܓlve+NdT]aB[o:vaz =ŗuEl7Ob61D| ]$Ev RL?zDf:0Z(F7JH{_ yƧUpǣx܇##\.}}sMP ^$չi,xjf}HugB3U h',u:|CK6BԵnpsǽHܹ1/v1 ܯ0n5%켜')c dmLk_t8`%;`\>Bzt;G#`R5C6u6+=M+!gi^"MA!ćI%fxM-QkQ4?1֓B)QjTȅS#Q v:vuIcD2HfI"HO) 29 )@qlnK{< +plb֎1/ 3יgz<!N*J"fܸ@ꣴÉ9䄄+$ oD\P;;w%kF8ShhB4Y1nPXjyDcN7ǡ^`Ƀk0 ҳHVX3Fpssg-)BLi7DN$"WE܌j}p:[k`LIزӿu]XG[v4Ǚb:$Or {Zpy{NcG8[j1-|#'t*ܩ'r'=rȿ:b HmDM%'?-[#=db{0\7%(syӸ}HokyE>7ߓWs>WV4])p@_wա<)lQcEp J⸒{&HFտMYroaS쯖dSKhp܈\P7W׌nkR S'<؇ɬ3HDu!w|!^&{S;o~,0R!)Ac$oLk`7ؒ^C1l6D֛i˦+-ӻS(R 9=!8,B(u0zRXqς"y1 Tc̯\!6Q' K^vta3wT X1xϪ 3G;E!c֑^c簛l <ƴ-3UCV\i3c&<2fj}zYA=M*C) Hє,Ha*-6Pܤ^Rh宫.~oq4TǪ+ҙ~ rHVVa_"Ai$j i֮bB676t4M]m8~+0-AQ#əG[@(сjK v}'*] &rO[o\`aF1#rי=Qds%b> U}ŧ2k8~{Wv-n0F6 QLY؀\,W?JB )}Lw( mKˆS#^MUQ:1KuH!ix2d)GƖsRl_da{^"Q{PIz4vԓmu&6Ip_I"|e㓀Q\WVVeυ5vLjP8/=WE[ tqDX 喣& 1=<<[Bw^Mm LW> Il! v"e&X17ߚ5͹JKPAm:Ud-"f޸A;h1 B1ZAJKpJVq/1 J<,@=;ػ`J+x- gZd̶#2в iP ժwˬsDF 'H&$di t#۽ PUn:ʒptl{&6*h=s/bjXN3]2#eLJڄ=T )XZ'Lޗ+B]%s=FLa~(;7mkynf?PY)g02R;Zєjy{Cw""OI69UyGD/K2/W/HFF)}%.>Djvۼ[KTHJbpaxP-. ır.;0αwg[6R26n#ivfhݵXF5-K5?xJeˬHA':eYJMe~EL!dv^ rEmh 3V%݊yCL5z@:tk}cDy^JX"T;fx+ZM&嚑m%ojop- keΩ׋'4tz,aGp?#%!>jNZ_,kqr e4WN^#=\i>`?ЫƊs m& -d4 'J %o ;g+AX,D*~!X/" 1S)S ]"1iJE܋&G~$LD:e![̡aDt3,5?]R܃m8Dlk6< $j 0oǹ3u?oVu1bauSZAUz,(ܫL{"Dݖ:g(w;;Zu^ 3zsn;WuY1Lޒ<,%D֋7R7P,C8b2 B^JR~E k-OyJ NWl/"s_߃~y GmyãHq`Iі4hOͣ!SbHoaE~$?q6!*Ĵ;,/Aq7w{/nŷfkų<"V%"٧/)e[ٛ( ㎮y :bRfzn~ut=Rj7=XHJ(X!X+qu9Z,?]07, 3wlPEV-rs͛f;gNKnF v6mp:(:oc#} y(CgRrY%ȡ4KD=»/{|N,]ɼ2}K&q3&a-]_(k,!1&L1amN8xPj` r#/Njw( [؋Cev"7&\oFuP !^?אp(9A Z5N4yK/Vp{.B3S -fؚSP~+6gzs^DA8O>0kelgi~DBJj^ a̾MF2Kh1cMzx.ػ%}tVc)q4DO6m ё?{J(axngCjs-)o4KinJ~`ȁ ۛ Ti/Z_KY)a ϴ3f_w`_0&nh^NNb.VPZt+9-ViekvUμxRGb3NA7#Zt:*δ,J۞߅ݲ{3 a5K܂ kL3@=Cyd>;|wyY+rI E6-5d2tJA RRd3HL"2O12e#?vOmںQ~`$Dj|ᴡ?ߍ"@UO 7GM#ȮJ;(-w[ ۪%{2Zjzbbl%aSU1|Ta2q(39]jpx=cQf4z$9h2XcCt$gffRxœr4a)uȴ=3rӜvϟ,bqCi_oC[|fUBwAwNi*}z&Ȗ eGSz z?vզ8zWuwwCw.Jj )vl{/ l>6c֑iMeQaVVb[@f>ي VRH1[G1\0*[Qt @p O}3>n<x#ڗ." : U8oѭw#گ s$Uu/**V{,\> >v2nt*WSI}s :]x#\:ui1¼;+4_-Bj*Jךni1Q* {Du)aA>xvrk3wOL!vsЋދ0*>?ӖM!F5^RE[rˬ#9$|c544k kqZ~d,0~w51VAz&:ylL`I1>/~<^R^+ x=h Q9V+~;Uïiǚz2[Bt JTFC۰Qal5VKNFkiSH)*}obۻƆGW h .lyls?wrQzK,J9Oֆ u}Zh9DdrׅڑyfQoc1ѡ'A^][{=nU9Q,Jt%8B$%[ӐfPӗvc;8% z6CBM0(+k{a'[`0 mhvHzMS;u%kԄFJP.; xhzy&1 {80t  dD[GYdU@"PKydvSNFE` ܢ☕h<]B>+S23 f}mz8HY5dۍ>ك@{ty EP| @3; [F?ݡ YO5;^Iۮ UzcrE%@T'aytX.an42Owy "HTǁҮa6!3:(9m2qd,5k`7#04u^Z~V} 7} `4dI+x9pi{ó;3AQÝcgykݒv`R[a9h,0Vj7]I0xrzs񶎲Fޜ) b( *u{kaB eHM8p=cݓu M^0n_=Ƣ2Cy2 sS834 tbݘq%eƆhƕ` 2A/,rb^I," W05+HXJT%6B.w"m $Ӂ8dVHrBĆEH-dI,"9X q&t}Ax%t:Z@ ^e>aml{?m+~ 0у1zrΥGؙSyp= Csh:ȧmB7ܙ9Ux6_=/WWJL'Fa0)orRQ fO,CH>JvLFzd|Px~+Fubo 3`V+`e`\T ظfF0 -%e y C.t7[PVeIKCzIgWP)$eͭSVPhH4{Q9dAڽP%P94C,րf V@=&@*&zlMh,vj>YA,G})0v_q+UKRRWH]Bvi4ȇ Λ.>rhG2tO34N; wE?!CZZ5!KNc ^B+nUT6 ;-@PP@*f@ icW i$HV,Hߢ,i7[`Vz O6}"<g@ }M#P 2qBOo `oxwLWHÈl//#J@E 2ECvHTfZcxC*A[17pu>;NEt/6`1:smoi˜sWYO*qILSX B69F@`P@5h ٱpKuRPANȷx;#$tS-cDž}1+;06Nr QIv&qeA5 Fq)j=+ opZ4gSŞ6LL,>n_К T5%j{(#R#Q")Q9B(<߀=һa#BCw"skޡ8rM(u\{$O MB γT#^;3CENc"uPބY;NQU vo&-C_PΞbb~]~;}lk%ԃt^lk,RXم߷7A$\ʣ:seP6y +&sO)`KaRI | 6{ o ⦡5$6w<}r-}ż%1˸5Ż4=.VfnZ+,U=C1aI>_ښG(cCf]9k7&!ky$x_"s. `DTT9jVh0|MOD*m3MM"kv H-ߺ> Gc;h6 GΑ2T 2ϵA2ZGBnӃY͡gqrQ1,Pe"x-mH[ƹ#~}əc y* e7xZgҔkFa;|D2)a‹:A?wY㤉X`6 =+kvV>QlAw@u(Tv:Hn8@>0 .֏xr {c5=nHoKA/`]I- hY0y̋~ҩ ,+X ˆ[ _i)A]8yW.'n="Cߔt8bsK;A)c&c:_G^>BB7{KCz$flJsChI!mkM-KntNG]jNu%|N%kޙ81S\~9ab+ϖ`>b'ddzhQtN%EI3Ji"R$Ry+Joƶ#l&1"MI:O^&S\^ɗH {#= _z?,F3m魯>*~sb%~] XM/J / H~ܓ5yv>ٰgBh`!F̸^}S-ì]oy..]ьIL*%>Þr;qoE[5BVA6k6[Ee5c,r@Hi'u;a1C tg")Y_ĺphos_q,Wp#J(ͽIO;IĘS W\TϺse@EU\=Oj<6Ȏ`fB'uaD.L<ݳ)a m( U}}`C-81(8 ;4)d%E2/Rh6}z%XcB~UqBxs|$> YI{YbitMf|OiR[Ȝ.Hmey(#Ap`4o~38cL ࡌ|:j,A #'JdVzx"^?&iMa-Ik`|d=sE|NH?C1B7z3J-0TuKȅAY$tl8:}JU qOncloaoX\5J"1'&!P*sKDmhǴU1\;ԲD~AۨGCOAF)99'nߐt;DH߅nkmX&8v}\4'6fZQzU.0oa/s;ŭ*0CC$,cS:HeSe CyX09/n(]eH=bZb=~L= 6CujF٨s!?U3rzY&5E)Ef@-Ձ{{.jm˞}!es eLnxCE"pwdI-;V9ZS w;4E& )Hnh:ʓ(]rQ^K7/ïx Ч(-ΰ',k܍M#%2mQ0p|+;K-hWi#Q5gcE+-"MY ~L:Yn\E]+ھauD$Nwh i5Do[sZVcj㈺fu0 ӣ"g_)IʆR3k@ +o|7iFy I7eRfqh <ḑ{r|gWC Bkn<lޭΝSC&ނ팰q`>||os+J7N6GcۖVU FMTA *|Rf9!ά^T4:ٷK͒r'_7\-7; p]3\-y{qmJ;Bt1V&}}+5bvhŦDukN[- 4t5KAszj! 3l ;҇6iuB{jĨaнr"\̓#Yۼ!2B"4vc?я!_4nuz{aM'u/Z+5$&.z$6hFIf ]Fq"'Ԟ; R,qыxachWc3}Oq eZF\?t|JLk6jKZ.q5wfi gE@UXh;(&dx CYUuX~$tEG-|J 5pqmA,vatĶ $?Aa|m%ʱCM͉_QyALǹ&ƿwimh3}.pIWv!fZ:OQؽI}ϓ8MV3i~w]m}G+u rfZN$("dm6_s'dlٗ&oi!tJъF#fMI/w@w|tOQ܀&_B2R'˨,o/W2&a{ӪsReWi;⣡|)DΕcLB%#Yhn۰ިe_jĥidc**ŸjD2gH,V?=C!&'t=œÚڪIk.$y g2ސ(yj-Hz S8\CM?7Cݘ`N:NݤĐZ\Je"R/)𤠄`6BHfxNznKaw2M_[U>w7i5.7گ5giP}Rx"Pk^9vN-yhG MiS]vHØ 9tdy iΨ==IgYAZAQp>4UЧ/\2¹yZw@ˑq}hh}VH$6~3WѱFv6TS|vN86 R'q)jZ5&aXa5c=;:Ķ3lT RmPh/'D훝79 n  l,&blX0c~4wԳ/Q8KץU|I 0~@NhkDj4V>E:(VC񳼉7^Sl]LҾ݌h:{Cl2DthAzڠ y g@`` ~rt3ts^#n%x6 d&| T >pM 6!Cl࿟f4$z^p>s ߕ`1@6ֳ* 8|t NC#\:&apĺ ֍ 6oG6 퍞T*/0DV,&R 7AMx"G5}xz.[Ӯpqk9ZSE &jStmT}׵2'%lfE@7fՔL H]j-{5~ӻjq]ǃ["Ꝛ V6! %2.Vr!; ~̠0;5NON^5~;SJn3j(QK}ee&v&  O4\6©m+gr|޽5 zf%*Cvd9)IroR(V}쉥ed>[Tg5@_[n!](^lwLjntV]z8.2P~27h77WomTjx%mO-b=ltصaWJOýN Ecԅ8*126 _Fl(kWL>=|6 տ5sC( t\ s>eaݰD4=Ą mu`w˰wp1ƍ SKb;,YǼ?zcC"δq%# s`k p&48kM^>x^A6`PiNؚu 쟃<{w7TG#gaL1՝ Ϩ$tְ)CϽ,@M[!P=H3T(S$ىT,~y'"Iָ-DG넽9O¸'c>6\ q?ч;3 ,y ײWψ*i/5BK#ލ_'CWnzdwLp:v!t' 7F ogg:1gut=8j\0VK0]d"sGV [Uq yv]FAQEbru]ʲr8WL { NPBlwYpxS5[̆uD3`\VX}L6}VGMOD-Qo&k<V2aΒ#_|uPd>ab >1pyp ,Ry)/u~oT"U=3 Cswq MGŰ#ٰ0 %ӁM mY#V_}2xNQ=>kuua,$iE}&rXq&3 p3|{;zbf<)LfE# ( HH o=?˅^|b8E} ';{wd#_"jR&j/~3J E~NOwXȓ>0+m^#Ҍ9)<Ot$ -46B3.[aJ#a|xV yU>uLsb,9>qr@wb۩eEL?(B mHXGl7kRW (U\{In.sحlqi &JCg[?PXJ+q_;A$4xRzpr7R4( %菼7)oќʈ'&oF yv L6E]7|鷲X#_`>&\^LG$)nCp2RY<6msF_JqS TձhLNCe]GA^EHAV!`nJ0r;ؚMFF:ZF;%jw/饇)Z58%i ON[Jqxjg\{E=tХ$X䫎aa-a;ty(` JZ7*Mۚؕ55L&v0F_AlXWlMnM$ lg5q LOa `C[V2Hwa{h@[`J}!% 9AL&x&Bm Oqpjd*鋄p#Hd,rcA+xO^LZ ^An E@:y⛐[puX,rlZC<|ƈ&ତ) T3|l} y]|"x1q03hbFf8L1`.A)k)I%Adr@\!ŕ6_~;6MX*{ H~>[dD`=P@0qClp;w6s0_;\po{Vs>y Új(B!"(~Kn871qʶL՘ \T%`C3^*nӡ 7/")&P+&jscv@07C`41.#N fRеLZj;PUFo^n&5HH=!;aflV2 ILي;/((*X ٛR)&n z_j?c*Vb dG1;D'^~s*#z۟YKP")|Zp]V2]m7+Z7Я8%TA"vKMf$`B-UkgC~MR7 CRU}cei^ m@=,6xo7]Q=n7amBm)< Cws#Z G\s biS%yv5)9|rZ,0gH&x+\Cys%}UQ/1$b3#1;o7@{ExI΂:X!ڲlrF{XC$ ]olFx5oR.~d2rJsutߘ@Ju6`1bhc鴮36 P쑧prf66@t g*kyiTg]t+=̿ˈ",nRCu0R^ 6gv QU-2Hq?}x ^M&:#>Tow ıl}W*ѿ>CVwg9uaѪSt6K}Jy,S/&;1U.gxٸFft >Nvsbp ա'X"SZuۏT WutD70",Xc}^/g .T,Z7~i[JL*$ Zw oG]| lƨ6i-,R} #v95J[x7)[q5XF=oxُ/0!i1>ݩtI4BKMX쨵b?JQ@ޗ[KJK'"&UQ_=z {Re1ߚd3if$e. V1¸4:u%ii,V$*elɗ0*[+ lv͈:ms9jϔ[šnY9X%ᘷ&JJX=UC&v&Xxy ec0ɞ16p7O}RVf~ohL%'u7PP7(݄_F݆mzc", M^iFEh f9z83ElChl^I֮}F7MCmg|SWHgyyO𰭡feώDz]&}Zlwı0slr]7lηֺIWT_E6+Lt7gF-y/[KFz<rxUE6dV'E A .MX0cOr}K3qvkh%+;7/>z pdoF>?g$(e4&v3եujv”:Q eS&vW\nd-HN9Bf%Aylh6Wkr[33Un;MlR}WY<9qCML>)Us~{%?RO/)k3N7],l [W*˾}ڒvg7ȷM1>ekz}xWfEtT`J>* 8. C*^і V'Q<ÍG@aBkRz]杩N_ӛ5UyBبV= dle5ʠ(Zhg4 [ys`e`DNzHrNO̎6k;B8wW ᫤ ?ՠV?Obޏ`ΖbpsN|hڌ;r5(i;w +C"OgtClWޡ{[QLe%d)^pBK;ɀD0́5dc3cmϾ N:iu9{'Gf.tղvo[kؽ@tBcE,jpTq+;WONNJ:EZ-rᡝR&KɒfB`}#k:O Cc3m\V Z̛B2ۤ6nZr˚V&N3V5l}8PR:w['K}4jhԯdywYn%0OHxM: hZH|US*Hqr웱 }ouLij5ۮ~,-|XTT:h?тu= dc1+S:$+*zl|Y{xIj֤'<.H<=4_ozM ظ4^fʦ(vAq9*}odH%ba5-45xbF{|^-rڊU0TK]X( _rԍܜǙ$J\ׄneHc Zw6 !gu{{e?y=V@늵dRY!z.R&}[(cdMFl! [=+XPJ݀}]:.1ްVz|\%tbg"u8J(*pn9bJN~6$@Ơby=!TN_2M8bl߽i vWlzqe E۵^]xwsСqD},W[CXH<<۞}xR@תdL Ɔ+e񿮷"~r5H$ѽ3q j Icf `U%%@#b @* Zx.%4Bǃo_ =^g NNuvwU?`{{cxD\IBA9|L ZybszHhO6T1ݨ*yNdSM`9׍ܪrqYӡ5H n7"7o/o[Jj}Ђp> \)6n@7^˯L];P~hZQX.Y׀띩eE ;7V4ڑ5~$hW;ΑPɵ XznlNֆAV:&ܲF3-ݕ=UcDwjmT'Lԯ ?w|˭\`Ci;rti.NԔDաpjĀnFu?R;z5OT;_hK?M5>Q…#S΁RtfƓrt_Ki Pߢr#DcVm!~U} iҿv-LxYp741 49Fü@B$ `1{\Y]B$>m R Z7Ր^рHA3Ha*9 рȂj |#|BnBއ| џ FuHT!nCKgRHKSU'$E.2^Loo5~UbOG~cy}wa4 3O!O5gyO42|r{;\0Em{4|F㠠(bd"!pj[a#O\On_۠'5 yV܇ߍ7Szfs %v8F=-཈U*7 pmĚ__.D0Qo Ep ~ ůg6Mc0Kl@SfazX6&G_60jvb>ѿW@Chx"4j&UCHi?"9*:J^Sm7Cp b sFhkO!@Xb=b*gJ[yOPv`PKR 7<%V> ~Ѥ#zQ|Eu9Iē[z8R6ԇ43~AHq^aIpFx }x%R5M`lsxe*N`qF{BXluFe9JЏav*V&u j$3(-xy'Ol8vGpi4= ;%8 Wz^CAǺ `ݶ)oh8[ccmXBr="oUϷ0 {Ac&~0.S oWP9yMWˆ~{j%M&^/{yp_|*\U}\UVE=Ha^4ۧ)iy`4ag[Х`5^ޡn p;Q'h-vPd= |@-Dx` z;䠵?z%dyY c Q0t;81-@%<,wv᧬5Pwa"tc,xBL8߁jlEbQC#˨h]1tKHZ U>xC,O6jJ/)*%@ &B6a4Wc F bެ?_`mpn*:9R7 4y"?b |&sľ&?cYkēY2dvHD+9#w r rvdaXs3ڸk;:i8^A[5[\ X.JH*Sz ֟_#ÔqDUgQDO4,|7) 'hх¿khv*ŞnKSbnI5?b4DѻOP\M%Jj{}<&i@9v3^ jM8QNGwnK?M,0xI~xlʪ%'0%#68GI]c1Oѹc{M⽛6"Zؽ[Al;RaƱ< N(`jnnERo馨7z~@J5dPgT>4D763t`a0p~%ǒlH2ߴ$.B+v1{ ϤOBB1{HJBReTuŨegv÷YDnÏjDž#͜SX7$z?zڱuڃK9MqBIPݶDُA7.ƪX4*^<~OD{IJC^f[i`b0 _)"NbZ鮪ߊp@:Le#:T~~"EJFzIڷLl 9$s'9>Xh+%[5-f7v*&A}#c #17s}G_Rp6 rѪh Z?+S1F0*䥰NP[ 傝I __K.#@|9k.n'cBqAp;;Y$âuF lSŢЛ&W ũNc62W8\)w2FF ԩGzsH ~=f]prG3 }yXG܎s/6ӥvJ1'gU3r+M]xUivҮ 1`)Aն$uK`PUƏi.o;p&̗xқNmӤ>1 cQz[W_ ?<^`c9`&1W]hU4Tw ~ZK|+@mYY.y[|9އ0܅|jAOEHE~M*u,<Ř#fahm@9!tӁd`pt(6@{Qa{d2j %kZї <+袃yCMFi| *;͜鵂R@##2o´u 4HB376rOqJ$dz)7OCBZ{#RjJ$@ڱؕT_InԳ]l30m+~QmY; vHB9@IǮt ߵ"F͋u*_gQ6kXF>!Ţh|awPe_y˷CLK7h&X?P3ʷZ{3vZ:P܌H DɖT{$‹vބGa3t&0| n»5^ie6wmH=Xv,FbSŞ&X/?gJ_J-'Ŷ{ojz+UR-j(B:|D}ӎLQk>j'p\DC[&B;{R5; )7]x{Â0oUsd8 Q(sU"ph(x yD g#? r+ uoa]4eDk4̑zxUP4#7T~u +Մ&H{J_*d0A4jG)5nQ8-POEJ\cg012_4H= s- Z_.V]HV6T;7lJJ'Q4 t> pZf|w EiJ ~ Zs dRT5浖mӌ%MrGKxZ9ZVq+ NuSr"^Bp:t}=-u5MͲ!9ޮqSd>g l׬aQQBu(* |!ު};n6zA}ˑY`!Qo؃vNDFK$;[& \UDj[tYQk|ڐ˩M7zk Q"ˀ_Op\%[Yx©5hFF0(>You7W0Sڛ1,SRpu{r E g^$c , .a z=i!r )yS169X_]drdw3L-s5i$c;Z>ՎΊL%\2 oiW ﵷ)7I>oP2kV5pێ趜rhKON΢Zvlig-%(?Z"Oyo,72Y5o5cB4pٻԮ}kChYn˃b{ ^z!/ k0 ( t]cvwl|z}ake}3EG7EOzB|P smc+e%f w93k3&W\;Gi詰CaXooq9{޵gWIm{!jbZ=ױ&q<~cAw9oQ_:ev+FCbGE~J4lgm:CMlΓhcd(do~5w{-Rí dV{ӛjس#tRtFf"!0mX{`7 XtK,z Cc/rdc[86ІĉlthvA{QXL_$ g{-d[ũDA ĪJQu nոBÂ_j:yA/߻7foVq  nNEvkz<`)(PJg ?J8:'^z]ֵMZRhluTaŽdH3*rZ}ܩO=R[)Ϥ.R`HYwrbi2'u85wX^|9_7f؟h( QFhh.Km5RW,[O:Az(;ʸ m<3\=;8ɭ/ ໡ofOz&^ieJ|ԺXZ74&3OC=_`M𾬲'IeDJ􍕣l[jܵE3Co {vd4vUhDmkGagenލJ]߁ʝZ9?^Ax9io6XMn7[ H>kvb/7u*rHʜZJ[,Bwm+GӚMw];#ɤ ھOoy3Xruzڿ5I.^tBT3GF h\pNƠOWЯ 9ɪޑ_48v:[QOYVzvrNc4m}᝚4עykZy>qt_/MÞ<~o0)u2 +TvDQcsZ'SsbScM"ѡ2}{txj FZwq 7mP|0W@2GWwK_Y<#|aQԻ:i+Nw~IL6;d}$~tJ`A9nӛ-/]|xBpW0,[D Smy7Sݿ4v֪7* hdሲ%|@澸g^YSr-70wx2J26Plß̠вщȈ޹ ˺ܝzbKiuv^=#CA(/pR F%( 1N\j#⎡7ৱ$,{/#?m%n .c2דؤQT>.Dݎ XwQMzL[;:[ :ry1ˁ1o:ZU[0_,J[=ڶhigɠ\/sx̞cGܗg|-9]|_Ї11X 㷟Cdۆ; \9M-v偳)'+}XH 0HOKS, {k f+E-gƊ9ycPWce0بh:2$;n"ߊK7Aη@[Vr |v[i:~ydvΞqopN߈ rKwVf5JA60I09転w1yM9o=qxhdlH =i =?iEwECSG$$*y6;=Lζm-⎎͎#@s'S 4lm=E8ɍBE4}(v.+B#mQ?v}f$@vRհuuEz}v5Fvhp0IvgC;NAoЫcjS+GGⳑQ>Z^]6:BD ~UGAzbB5"#yw [dh"o[bюc4L* Njq됱@|upPDKH.Ho6 O:acE^MYv$_F?%G1W۰D B~R.w@CSJi"M/Pա9t#RIa~cOYaq cw\!L`ڤy2DY$4C~A' J1X[ޭ/rLq7x g ؀ gA5Zzg"Jo.CJBc%e'DGqXo+[l3}c||n!|OآOţvh'[ת0[YCRQv\xU9qv零g|AXOdC^ ڵJxjKboc6_p/KvA0A8uZ(x`"##n }rdukiwص귞 8 lr݄)(`ۯ]p"w`aig"jx!څe}{0Wt)k`B1_7a'Ќ#؛#QpU3}p]^~Pso"D = y^`lwPe173ȇؗ Mp-#  xqov8=ON"7m? 㶛&n{b-7#ð¹{M8)P\_M|P|7_.#7vaGֻe;k-<1-jS CKd`Í1Ӯ\# ?K~`dTm f  )0FLw]dKɣq`pR+,xI':d UoOi&t<<>*$!0]L]s/5}*C+޲ϝ~Hm:\gQY )9dtwM+o(1wru)9M$쯝s~DS[IovUE۱Uפgb:ߐ,A: ןh$6 6؃tZ|챔GE6i|􁴚_~̫mm1X@sF6 +2`8+H6LcY;M`QtTbf0ĄF9>`nw2|hs{zSj%>Z2@3!Ix_F)k7@< * at <&a װ&[ rQ,OΫBFEx|;-N,;O 7'RpڻX cjZ-ih 2AxW&RnqOŏe#Ia*Ծf-` \̼̈́G'! 1z*@6[ 0DFAڕ4&e_&1?D]Ǽ=SS2hnO7f=ƁIhi;}L=~)Άv_ʮg˪w(93*6pJU!$w!盯q(+ByJ;~'a!N:TwrIQZ",tqB$-X 5tS~VZ%4Ff.!c=y~yT(^q){U'}*=x7D̈́'@[ OO|}' l-$W-VSrc&EX:AE*$KG"%m1PXJ jx#o/,h7bҹ1ž/9BzC'd*$:O؆}8'g!hq\\s^5}%w %|;><ήfٛ1ħřsl _+ri<06}շP"q0*YbGv^W2`;LQWb87SrtQoiB +PGJriHɜ::q=]lP$[Cry*E9E7ʍ(CRs !i.6=$\ʑI!v_8ۻw.crB}6ʀ|Cd6;x1bG:]' OʹE[0y?^u8qȗgjSYt#5](G#tR6N$vG_ 6|6nl˥LUTK9KkW"W3/*m]J7 f 6p;5LG)dz'/_\P>6)Hl§b a8;Hz.JIӎCj:];Hهz)?eL1ϒI-bg|ȍнhȏ8`Fy%xՅ 48wԘ wU9 \1T'׋Ȇ|7֢ e4$mZIIFWQx}wEKA=nr<Pm%`TFqE)𒾓zNOP|k:&S2 *IׯjlgnA@ު , @uxݱ˵f:߭ > CAe+ hi?Bu `:`;z"pkv[A5pc*_ƒ"XL<0ǣ}ѵdeGn]v7eMἺ)cr58<:AJJhglM-c @սسqȘ)\cH TB/]f(p Fzcx 6V42flH@o6م!4Nܛut Kt=+IDm^nSgrN5Yb.MQ{F[[/˿L)œ)R0pD`zJ̖(H䪍&LoRcofN55DJD\AORl/O[,cI/ǦH WE'ķ\g\>kEd=a\o֙TTm]yPMsDfsN⠌*L\j7^|DFzG9ÕÚAʟ}G{..ti~ pSO: l<_ L&} %tQ&6[h,+ʑ#rPf61ޒׄ.+]/t113q?;KFqe!8d>/ [{!:#݅۴9bK-TxSQ$?u:N/i1  CWI"CVbiNR IE-K8L8?=gVnw#ԛ?vD:7 UH3NJ(yUbV(P2 }syZ_$/x**;\k rktk849*,]t848e7ᎤHaC*5lѭ=k]_+kRk/>#N MNN=mC G(EVj7G{()Y*7_W^"\G(ğ|NHB@d̫7oX#{ڬ]5wY 4heՓ%T_QÕ+$-ƌ2^o+ߎ ܰgSO8K]dz8Ҝ8!k6?P{1쳁c5?TXd-AG^]TdX/pƂU1=ot=nkB%?x{֜"04U{{-T8Av8:4$K(_OAtW8㤚!z`\,xjNm6u.Yub⅖Rw4O㑽`j[rM!%:zVQ"rǔZQ+zfP%㈀mU3/jnNTdo&tEZ7u@Uv0(,DRCWB1_>Ϫ9h@{.BBD)[Vq  u{evvʍ^c,~|ll4tAa%ҖㆅﶍxŮ}Dh+lCn3XFfgxrԡ ٘ L9kش3wv1~e[o`ᩘi\FMV >bgAxyF?WۑK/e`dci"5vO{3!o=BY?TBuucs}a ]/i2qToZ7Z:&6?e˴a_fGzCwv#hf}wIẶ]&4g\ )0u?W1:?~3o܅e=xW:-rLލd9[RUSqc!bp芡Ig%pX D2oqCd v^IF#5>{v~ͯ$ųO(ېs`QrY}XZxZQivHZ~cϝj+{Kl(~4\99 ;5ŇTN8vN,|!gNca z7 )^~5 ^plÐ=f>(.xUtNq7t'ݠN-V;´m wH;/k Gek:2$/ۅ6N0 1/`O[%pc;A/ .pXt**`D#Hi̇&:|Q|P]LԳ>Gw 3BHᜢLlN¯ jHz)rr\ߗG$%6Di=Di>m^l  xBqNʔ8NHDk8~n I1 ~P?E:Uӂ!\!f9XCe@:b,+ 5ɼmsw9J[?:Ƿ_tnS>I64FTVBT1B^bnMƇ57)O5ԲǶoEۋUUM6hPo.y2TpFsw4RƷh~:y:XJS/i'ǵ1,Rds pe3jvE6g_1j}9Q/e6Qde7I1<5w/ڏIh9G2'NMwN_b~!xH9q% gNfQjYх/"?Fts!CO%o]o~bnD`"m:4 0tOXzx΄Q[G_hv{$x9ɸ篭p7p4>.@a+˃+X20,X|m`B$·1Cp,B /9d(t|/+CUOwټ5Fyhc%lfvҵ RTÐTM WcÍIYeirV"L7E݈8>*,r?~ (ڄ[1ݴk$p`M!/z 1>.X%&H3%!JGFQUb$WA`xȳs"tkYIG@7?n1/]vHCΨD,Bu)!Ԥ,û|O;vn#/3=Sq(w \_ۦ*gQKcu(:szcp療U2Q- ȣ3?&tūx \䞎<Yèx6È;!~lEۿIH+iA/ '"0iqsNJ̕M`̫,| xOz(EI`-e-D!Z]J"I}%x:r!|B&_߀] `o`[`(~9L8\؝%\xd%1ۏFPWWcrX'*N"HMxwU aCi.! 1ږ ȿQ9) fX4FXw̯kHLuLp9J(d|h!7V"Jm{ċPOEca/7a{8?:3w}y2rZ,f̋ǵ/!C:Ez١ȪQ.,Q\9{ `0pG-8n9pk#"Spc@h[Mn jQsS5vo*)qi-),.c0d+#FHdjK=äh$cUw&% ːZg!0g5,b5 rLA~~\<U~ ]1剖\$`gz6eS&bp.tɟلjK}.Va"̓1'u.%o==aT4v-8裝ۡMtq fJD%/>ӛ:F|X6'vf ?M3H|=ęfi?y4{ zu-{-HH/vu#-iO(i ^8M%S$8G ޾FF9A0%R^&  %b;;4O$U仜S䅔'r2y#PK~L$QP(*HmYsD6F|rm'0v 3qU;H̘_陼ȅ]Y:! J*QeO*S/U| R"ʆA:Y洎$c27"+>T߫tf'1$[vp]2PiJ ek)`:ɓ?E<{hL69<)[xp _Զ D** JES_3X+9@!P''o!5suãC⳸ {*T>m~JWS!kd5j\|723E^qݽؼCgShq;'qF-0| ?.L(ѾZy|m+LjNO Vs M řDaͷqWed|ߵ(|@_M^~ײx11kh[]K)%*6.?ݔ gY +T,L #N`B+ˡ'P,%rDu b`;4a)ÚnE !")Dg\(GJMTJBG`!e*6j7B?GE;o59Kϧ)Ֆw(f̑K ) _aT5ez.'#a|}^9d,0uqRKrQ"ɑ7~Rcb3]FCqbi~66;D=Uǜd]hLH$mĿ^C[$\M}&:2D%MI؃2-n/m:j (`J >:,~D2sEEx9]qM8O m.Be;b,//REOFx)9 8<¨Fg !}]s?m~˽5=[S`' ؍$if&VVBu^.ɠőHF)Q]N8GxSYT/{OV6u8A])͟Ap  U.i )wK汪g@R&0{l`x~\gCd;Klų5guYA/IClVxӏy~5#u ӆg](m!?dK4[,md * !w].-P$3ao,3Qc4sW,\9kfHrT+Z_~ \oE=[Z}}fRDS2؟ uٮrw.ǕQaW0WAD?&e> sMXEvGvXѐ5:|=ۏ*1t?Z =LfAOU;DLf3,&˘w>!>fJ'2nˬ&ccof(]1DKLPYf̓&=bkz[i_f+} z%rW{_DZwmະjP$jX&)/8rK΄4z aå$ڬHB;4<.n(: H0cJhݐoDy"$0KJllZ314\ͿFռ;>Bv2H&Y ahFr>Y&r{EΤs d x 2ϛrVB]o[d4#vU:FE.`MzsE9"5n4fFr@Jq 4I<ǹc.j-G`# 2bB ?gaf9,U6hF5D`Qj!+00usq[yAno=ei50`P$*Ki&Y*:3sO*X?c^Z%d7JqBٍj<ީj\ V`*DZŵ83N,.y-eIm?0VGL<)Fl;?AVߡjߣӄkGc@gmU=-3 je"6ICYb oX*;R6Tȉa8TŌ )ƚ[١ТGvkGֽWXEt}a՛np~6.|j`qf̯Hg [`|:Eu OoOꞥh͘Z@!U9y,a"TI=Qh!i1W7ߘ-mAOVOaAr?Ył)^@_G}G(Ȋ؞H+T *SS)ipANG8-|dol|A03ѳ3\e~f:T3mTV3݂똱tutİ ,Ǚ gb~f7iE7qZz*FdoώA ;l7iwNV'U2ZF:/ I%3"?ɒ HZ8cfTGgJ>J7WvKUWJ&vV 3 6I=BI%=jpyоWNJ 9ԉZbDc[-FrO)\qGWKF|R^4f2l.[Эl.y]́Nn^sV]&CtCK[EWz>aӂRҤ6P11a{u xMdYIhto#UA,RpUMYѼ~D*T9g|*S< x0>FV+t?ѦQFq M又R==SjI7S哉;ѝȞLsSwˈrLn5];&g)VZsSaʵ|~ ?ѷPy]pRkn*JGi,-A߸yl]17N Re )yݗ4m mk:k^9G5ː)z@Duΰ_8K?/eBfdFu}b`4X.*U&3`ѬBԘE/.C ܱ73HG[a }P画)aE7 'ք>AQj즸or^EQX>=!9.V,|DK@Ϊ'XZX.*ᵚ[ rLz蘻2lvx!96mS:A͐*4g%Uh LF4=Apd=GyT_kN< NN1)$:6&Gx /~|}x'Pp ظJown9z2M $^}e<93d{(1h, T =dِw{Swi9N }d VNo.~F^܌:w⠠nՏQ0N$xȆ xѷ_Nί\ȷ^\5̍5y)6d즫s4yF'ҢUF$qd`k޷bي 1R5Wm;FnE?2٣#)pS?|Zi7P`{wWvQkILmcl^?wֵ797u򺎕voۭv8H{5}[qV5i.eY!i[Z„ ٦(v>NwsA/ qmYs`B q"#?*~A'#RL5c!zr-^}Iנ!E0VCz#@Cȝ(D:{" ѨE=:m?SJJGڧ0N•w@Ws+[ hHe@ZbIÂHۙ O ͝.lACލPEi c9xTyTD#[ RSͬ4OZXt.wnb1C/wa Ed,X >k"ͷ(q?hHw}  BݑTOwHNI(bJf|j;uRpBn܁\mű̼RTIANyli:N%rp1qoCYߡЩ` fS5Î>ĝ]m{#\sLߓH,iBB'&Ľ j#i]?z s JD`~q(eNB0 !rу_ @r×vD6ٌDիPRi]=zX JT32a/et/W@GP\,ww^e-;RGl8,B|gXIan\p˷ pFo͗;Y;;6wt350jU@[?l>\&Ȇ! %Q8q\$:ICPk^{ uK6un8rЅi݅ 0ΊPx6!bZy6;|[@3WU(zn.a8h<\2AM2Q|!Ne#uݎCfhPvʛNRCmyۛgD:dV )3pϤ[ g?e_?d ټ yd_?yN&$na&S1JpۢÔu> zA9-/Z1W G3a, w{ڬ$ωx`(N*ĶRIӰd=,ɵȝqusт5Fz^x|7ݛ 0jj!:6wk3H8?hIzGlRBQͻ 0/q`v/>zGDzkSĵ 2 WH[(ī䝎ģo&S#$:)$z) =m?\=A;TCў;Ѝ3ӝb`z4.=ќj^| G"Gr*a ^r,]_ a}ʈa1bfj_AyQ9cZ@ZpVnGq7⿤Pv3 R܄m_MDs-'r=̙v{4]mN JI\rQBXhcazhfQ $n>YÉzp^Bkel9Կ]%8#:ͿD:>Wi9b҄{эX >9҅Sf 6LFuӣuClGu {4 S]m5T}V(g1=fl^ ϟ:Pv,<*}خ_A^ew23u _gVVk8U̺r![/d u}2##h t x5 =H={F"5 Ǔ"ZAk[0~0 I s* pJj:]̈D>y}6Ө>AldZ$.rbF5%>xH 'ɼPA\jYlJ}KM MRFj/s$jJBU!wQwm&YFI@Ph^Z}ŏvXD]A&& hkGXPR Kզ#XUiI=ozfWt#0mPfB@##yXX`TI#^G䆐\4ZAJM|0^XJ1:y-+$ur"D4G#ZO.SiG%YEhPO{|XŒYXH`+IDoّjiH^F"7&ea9I+qcU͍rAKPݺx|^3Y{o5ZLh$S'&OI6isba;bz7#9ZY j sĞ@hx *u`\ey10*0#XaIrsޑng-a\H0F=BF ž-^QNe<XPohvMFDz! iLOPtEk1q-s8PDe'C lc.1haWo,y[^YnZM- IrwEsQ/QO3#1y ڕ/pҴZ0PRdOf訿_۩C'T ܮj]kˬh]hG~(ZW:2($R tE9u@sA 6+#(L 6@S}&|q:w-N5~HDyяT HVt(v[sƵ U|b;(rv8z25@JQWR?qU3[(UnUC O\rp1wR2?j[;dĆEZ D}.iTPwAK/Emf|7Z߇PCz iQ!DƶofU7DN`| 3mPEq.ebK Tu$'LPXR E4kwS teL:fĨ@J@k9 eb2cv(.E$O1 QDi=n~򿌕6@ jn`]9uxWUa}7;FP0˺㘡҆s!I6qVF ?iTǾ7cVw[̷Zn6t^Ic8+a|fw'<6}dYr!:$+d^c$gt/\ l&%KTlz m'P2"/ujQZvCLꙦGǭYeZP[x42=#mr<.E,P?DgfmnK|"5 \&-`̐U2^_i..gsE<߄0>u-4ɚe, `Yγ ]-Jn_TXB#hAumvBMys^lq^RW+_+y!82 .m{dbT顴v~h< @k-g/{`sfwM`)3O{QCR/sҌxW}*a۽\/,Дa1*?$|l^/ߨæb=hWث{=_(n9gHZa^-Cεu] m%zMs[ ko?,Uڪ `EMmOBl[zJulrW9<)@7`+S2E3=''Do*b@+$݁2(Ֆc혲$'q2'_^J)+ڛ/zUߺXjU+EIvMJ.Jno)Dwf&8:c6UTzak+h!4nG{Dh+U.fn_̪n >aU_ . Y2d0ț w+~ngWY1XPd9lj~+=J?~Yfw/tT_VE-n[fkor̡82I!C![^VJiMse]DxMZqgepM!r6  5j&RNOV%gI($N~yJ{  ٿ ['X/8m VEzya.UĻ4"<ԛ t*=2)wn2Z %u HyY bpkG\Dt='A+S{&[Ap-eZ&[5G\s)fV{*H`H.B:q4MDOc axO60ڴFG}e,DpBvVxivw8 ).KHsz&"0}?]}(֥{)d睪W;(Ķ!R[0Q.eоWc~؀{Jҝ#bwW4ޤ0o?7iNl }ptʉ!wL!GI뵦N^׽CӂCj o3myy#vN 5!0}teƌʂo}t`PbL﮳m1R0I6UD1ӝ:lJFL=!.wgZs] 'j_s+c \\%kQ5vz*p#LR^KwKWxwlg^.]I*ڈ /S .4BW{9AhՔ[07з+YoÙ.{&WMW*}!r&"v ~?0`ԏc&ү;n.̏ӕt-|Z}Z=^T6^*Eyq4.A#4=d'3oz{|n\Ӟ8# B1~Ç;v VCV.A<{uki1(Rd.V>.5bh{睬Pp\춱ؚЪ*#hDt#=&Or|a)lO](1 ޚFh7AnE\B} ]9x{;z;[7bK*1r$P/8et=u-v2{'}7;L‹Bb uIX>bW񨫌(bsBEڸ } r[PSȋ~E{GNpoo J2~ o6z_&?c/?~f1ˁ}WsZ2eZ*l~?wB6-?{W̖`Ȇ^{wCVy7G ie`)v0 ܙ3zi~PY;^ 4,苡 քp{z־C%%:^o{~^:=8yهLˑ2U%RTLnH IwJBvYJrEzCaaal|N*5i3 W],FT1>!i:w%N-HFI^X`X7űL?KF~k$) 90tl[xhK  @B? \#Q!H=nmɨѩ?yMq֚%Lz{;!4K`b54ё FCOC 1 X vگg0B{ lRԆ&i'cRfAkqx vѼ#.\}oWgJ[&IfbSpQ~* -^#'¡dGlh 9ĜONߪ\D[_aI~ZI#v.l1ok#^.8H{t2C YN2?:J+*/mНkr 9,MbvQAa=,\brF&ݠGҧ˜G q8(\e`sln>%iU^YH+TQ[p,fxjIα+|BCRuN_I_HÈbIOs,8ߡ>a* ]:,.!Mعc!%es|'}d҂ &UIJrnϗx%MwYi&m=W$jJO+W3kV=yg2ϵӵ~Ŷ;ʔte:";0XiS1;P$LT'u1xcPV7}{V+ۢt-.+k,=S핤=Ӛ"tY7[Xul9|czqlU NK@A{`wb>!}LWAK}: r[ l:} W^7B ZC^ @;N*L)ÍhkږBc_a;#XS ^3x`?#-* ]uQ9lWHjT x=ANNL{!jHNB ӷ8sաz\5@EQEYYԽ@Էb!ū@"[T'G,1v?X۰ui yeHn_Ww|sXpUA̢@XX4l#kr%gd?Gc"<-ln/~J%,\qN67wfRj'xuCݐ6? [ dk+NH&;% ta_@7D*tZw3OBY{f KjN[tV㙮-aHoGuc1?T<|Oq,,9Aʒ]5棿FCQƥ^e@Y GϪLoBm戻OW/\ =B7*Gmjm<[Қ3쵍Gv\Ag ҏ7Q T3ĕHy]f9wb++WcTFc;S?A?⥸&w =Zz&jePsmO:LP%h/(,N{C6p1h+G3\-R"!hA >cvmB-_k%"l*;-ğBu/B=+j@lF:QBQ|Q0wt1`@̚#L e M1Hԯ b:Av3M}p//UM_϶U_Lm.g5OAp/an\ט;|@dq3*OηĞ֗qC㒖bop"/;!>>!BMbϰZ! z}ؿ~ s @jUEr "D)뎞-<[y$v )_ St,krɳƉ)/|rqO[#u] :|0]ao#L%bvGTEGxYM) "7 [S[:lҦ_ACQS$T{ ȾG$>0L 19|Kk w>>vOBަ^#T~G9 ϼD>Jf&>E#J(l>dQ'B#uq*XO "!Ny+w9N&ę3hD<(uBK(5Sjybb)|l;R*:¼-eg/ )ȯ, 5cGI Dmҝ(=ry~!z) Jri7e:48.LO?nG'2}釐 mj9K8%u_0kϋqX{6- *{y'fm{܅x+NEpd!U!D,:Pe:tp&Vp$3k=7Rܫq=vCz-I )=e@hErjI(|(MeTK`#Aǰ3"J]nwn(f*)g`;zw#nu+j^"_hG=V̀Ϩls1BE^ k/;/l7K,0#(0xZFi kP=nnxk͓Ӏ}AX}@pbanПF b}^9ݖAO3 _XCAOAa+ߜi )`)}ʁ݃o6#jZWS(:^uN3;6~4ۀ@;Mav7` ,ޤ%|KEA(DJiqJiJ!UڦZB9mp?EZB5RHTT G=[!!Y厑rS4eAvze6+ȆB)o1Fџhݬ_ NS(q/ i1+:Ō2.$meEu![0f!"cŶo,gaq#P*Pp}]1FLTtQo_H\3]mt`xbbcYrxQ`$ݛ@x>bL$%5D0ɍ[`dH2q݇:?Z q״ J+<}%BUN} ܕr'ClwFad?5cl*Eܹ9nd 6>ʕ%*˝ 6׈~32-{jˊdᮚ 6Q{ Z&畷Ľ j! 1XsUok+>u_YӑޤZmK;YO,9_atc@_3$]endjr lm( ?ڂ2IgYl;KgQ3 99  =Ѷ/ځ8VtUrZ[|F$b 1'˘k}0=K0= !~1兙laj35L\/u<)s#T$0qaV$=ҮdeBN#B2 ?jwe]a<0Hٖi4RWmVPea@{V0 iz'b`Gwooj Tt A^Ǹj5=q5,n8 0,E F24^H(ݛk6=U6Fzy~id۴24uxZGtCrcm3^N+hiMkiҼJS]4O=%ޘ.]J`QGBra %Y* 'gpZ |uQ)ajZ^AT!MʰH"UTkفvO&D@AL)ZkCk{mgFGʦ}/o⧽5o )JuSh,|ﵕ#?PbmCS% 5f8_a[e8l'v&Z [&-0'"kX7 [:7ԏn*|jѬ(>hOgf}?htG>XЈ,4+> RA--$#tx{bR 4-XOUs\wF8<@׶Ḱ쩽+% j+ QޘC<9&/!֣ۊS/&7a' JԘ=ƒ55_u_كǸ5PPJ<rfdTk,/ 'U lqN7QI'Mq0TB/s„`_LrKR0⋤8HN6 Q q|"ndgk۽l?O#i*){H?Fn"dӫCk%>BXڝ0Lq,A`˪gEŒֻl?C֛5s]; ֥P>uG8rlgk4ssQ]yT]p8](,Y'8/ tp{)E)Y>[iˎP t @_!, 9}#㳖B㼐J7#_h<SXIVHǯRM) pk|B8e&\ l!SΆG~T^ZU.?Vw͍#Wt-`ֳsMTŇurſzM-mjO-ݸ=}IeH7x5ױ?CsN&;\U㭞(HHGQ-O`R% qz'At:Wv{D4+m`? >ԡ}Y`=7aU mY ^UrP<f5Rhkbߞ1ėn2*!ZKFS+> )g] }5cP r^Lɾ޵/LƏ5M$IG~R4yc$2bKdOeEГ e6C>5=^,noBW~3KlzLaƩcLÔt{fH|".ɂfQ+a g $#$7(뇾 M7$Nj&</2eU )p2_[+sHTA =؄ 8C TwuL]?|du#Fkf#d:1i>A&E!5dw y1M^!ĵvV_=&ZR#Ia9@9v7 AQ%̇IiVkh@q'a1-}BG+5;GM]ܚ-̵/@oY#+3`Qq,s=!HVu9K㏐N-#!]aOϹ Sv{ vrKQPN_R2߷;[6Nv A{a't "֭VRW蕖OtV\k"F+գd75> xܽ/#lz $^9\5z'`IZ&*V'_gsj4XG+d_-Aݻh%ye 5Дy @ qlT !eS8tBR|l#\>`aO^ԧi iUA!\7 q? @b\B$x]LD1|E58r'O\]ŮF>n%{V#[ށHuYdfk#4r(fHaH>DQCi Vq/6^2bʱHƎTAT1{|.#;%1?IHY*k')sQC&t;}Y6zƽ1 1p'}&HzQ=o_Q"s Vu{%oQIBSZW4,J '}Xpk@pݸhvZk]/ũڛpʢRxfu&a4%=$#ďĂ5+K{zEJ!wMS3dW}re&ZJz(S} :Ң )nU<\4?,3Dphw G*ݩ-լu>n6@b|} <М\ta?(h~^+Mh)M#[F6\jSЯvmO^kL{U&xhU*\+].dT`uѩ=-ե=02=h ˉ'%"z]q6%U0n6f1 2'׸P{48u8ryXgGD3ȃ`wp j=N ݂EpZ.T(z}}+Z>-/\O9BJ#(h7)t r0+ nmݲ EI$ݦ.~ Po n^4&%~cb3enY8ϦN\ > E}C\eHq/IVTfe1hԻƬ,"1YW-ߐO,B)Z"HIdBqqY?QG=GS{1i }TC Ɉ./ B (CĕEr~/8"LZ/ad Q̨.hE mCBHw3\FIm*hy2B.V6=EhX/CP! .66~76&6m8VD LŹSy7"xdLMYP,np ?嚎3Z{ H 8 ./j̃XOYa۸'It F[ o )8vp˅6vztFR N<8ҋF(.DO:aRF|< Ilj@q NAMXxL¬"9k\-Zj+,KY"z٨]Gx E]%\&3z\4/u5@hZǡ' .@]Pm_6b5n/ g 2AbQX躀Mh7@T2vHׁ$9s'}E=#5𤾏 .1B3ri7etF@+m{j~7s->Zle/6XN,DP2P&fu+n{Z~Ab R9 Ig!kq2XF`cՊgQߑvG3D#OQ1ݚC3Lcz78 D|ത5]ug6ʅ &w$MLg_,_g.1~вOBdUOb)|#rʉ$Xk2掣5l򋣯a9CDDuPW_-ToXu&_;HhJmsl'v.[S|x5t$vFf|X%]X:UOH$TJzNJrD G!aHK ўK[^Hx P GRUDŽ)KR|EenTiՎDb;T ۝@wlnB:+]_iѨֱ[ڄ(_#@nT!7Ȧ-?!n?oA_ VEfL䥠NvLw|Zg[kp u[O Уro ǸܹJH-݋4Rc.;yh3 #1#',iIDk{㕦ǀlPN.\#P j17 lM!~RǕQ @[c=Xظ!,O`܁_1דƘjg7-ލ"<(kܙ=B:#TDt'ʩav >N/ýMG?C@s>d;SLgJy- L[^I?},U9{!u#{"I ݡzOҎ؟o+{Y3\la$cǍ%2Ēyz4ً;@!nWTԥ<}B^/%gҏQ^傖6oK5NYxWq*G$sv@iWDQ/Ba?GGKy&c0¢FVE`3MŠE :Oehm`jRttx+h<`s J~G. ']vׂ a &ybMAr_!Q PM ҩ9?Ӄi[/KLp'ٞ憐w|6uњn:N>;OZl,70-nY/rQB~=@h m6B[W'r׷ԟvo14^S/jUoT)7b/8(ol+4֩Q *@>`?Mu2Vsޮi_tY|=sD%JC"$eQGN Jr(M4Bɫ1"=Eop- &O!DP};ĺCNq۸}ׄ.a@gğaK+7B1cH*VKxLa GO2z-\F.3NWant^Ǩ*8:?$oHnr)&ﴔ*篥 2::/  OnʙBtg>MvS2lyD<4^91{@ǟ:֓xtr4)ᅱ?,N\7S+ac}6rNb &rq09eu\O~1B~t>͞sLaG8p6" )'K'+3gI-ʢߥy짒{wJ:c'$Ea.lf:f7[wE_Ma0wM-QPm:*Z`]S=:\u\SکpuˬY4iI8[_ `7qOwۑVzx?ˡ5T;zyrԸ;b~T5ZgޔۛEClK.RbAǵj:Pc#6[@ j G$>TSUsejTSUwYζ-n%ӞiNzŸ^o٫00}z3B 1Ȗ| 9NOOޅo5;GI* -WBdR /0LWh+ bf{zWR2*d^Fz^bZ},c+FX&9MeЙve ˷:Ceo"gdČ@ki!i}LľFNu h c.+ΖbNqG"̗>BY" ]8=Ff]B`)\t8c:+Y\"2ld "/vH8~gR\$Y,n_3s*j Gl[qF=+9Z\=ӻ;h;mm[󐯜Ҵ X$6$Szov 2 `Ĺv ֞,vHtM19~$aWpj:fQA%QWhNGQx)Pyn#V.V2R_Gj{?n~$bTYtD5CS8+д{6 .{}%}}ZCMN7֚ѣ*T]wAJcyES#a|-gי0swxZCI.66UE9*9 "ܙKp*.]H%hz >B6!Y-\P"*/BfeN7"T<0`^WpurfU+G? ?3r[鳠p=1SxNfl,z)8*%v5w U= K~9@)R&U@I &V&E.y0IWޘIo]*MTZ]vsBÔOPe ؾX7Hra~tN C\7Y+]6uotąg_~W Qt~*P _i3MmI<D &1={B~X؅E.H؅0ޡEosl|9`IBUԿ{} zKKfnq`wm8ᡉjE;!g |v~(ޛĠݿwuy]@emgI?)L>t+Wp쿉3ůMxt Lr1Dsa=\nM;Lvbķ8Nꍾ$2GBG:NԧUzojϤh[;ŋh2ͪ drHoZp쯰RӉbMgMzOa׸ h+8GIi }+ PݝMq_:/ "k;.1}.+4{3U}HtHt W7W=1. h{'Zwy5C3j K'Yȋ(ӿ9Q>@pTlSƑ&F? soz"eWQa@d8)HtOWjBWg[ZѶ.CFJNQ? )ʫ52U[#wMM-ǀ @XU3Brb6.>3p-ݮ2Ȼ-튵f` vQM4_?x9]pг clk!$%v5Ÿ J}"s$Ptڛ2 s& /ǯ+6eM3sh,( >PJ`NEtΨ'$)9ه^6NYnHyҜRE]YzV9EIo1쒠HFQ<۾.'5(1/`ݡtX6jVjQw-Ij{3Zv,h?ѶzjY6~q8/"cM'ʉZV詴F+y'bH]|Z}}LT|]=olsxKoI.N <vlhϷ{ RKj;udw]r]TXEwk\(V?ůB5ˑCସ(}vpn/ʤ˫څiVfThCf{cEPC^?|HޑʙHdܓ#'慷ե*)==ל W> _)MpD;b,-wׁMPSu;äM%Ɉ䖁4k!xd zٓو_BuM1ɚ듨 PR c7W#`H,ꐧJ9[dHulk%Q\A{`a-zE9dm*J7zFP % W j㔣@Dߺ&C4!-!#(F'Ae0 @eK(KjnV}tR|H "0.ZT/#:ea.J53O(Z sRsfeqVxQ%9z,"nNHΎ.?"pj@E]S>1IH-P)ozI(o)وM1O"VOe0<r̷:47oRKtS<nq} KG M+b*S^UVHZ-oR]f5rW-mIQzyx̰Mu7td[Np*a݉mLE?cn\#0UDw@oD876?d*( (hae0$(sހ$L"0].,3vTN=oB|F/kބhjyb_B}x6npҀ nC_j6U\''Ts$i9.C)xZ@qE$.[|S.e>ҙRSO"W51eaffQ9ą%h ֥v܌)e6XN= ,k&{W!y\mP+4 jlAWm.)ˏh.w`=ȵ.u~ V쒒5f JbJOq-"@P xTeJn:&8iKQ 8.Z HÄ6 yTY%xJLDs4.eVT Z/sp9>+eXQ\A;}̣ UlMO{B^:T53\W\nV iZ[H.!ؔ &B.=Jbtxq15MP.pyk;V02Ann\)kCӊmH_1&:욪 pmu%7e#`8#\oHKE9隰9jbEm$Ы1AnWq(8AABMVrY>"߼ *j`Euވڢ1I~֣n$|| 9 }<@2Zq 282\W C !zi)ha"QK Wg={MX- J%ՄA҈y_a!$A֣Ki.62̻OMk-r "+χюlƔh0,⟲jsNiuNcKYíjQ珂-8éPgLq_5yhZ⭸0}}>_c+F#ׇMO(6 Kx25B%^%«'Y*\@7"TJdTq @ev_}MYaT TH;&‰A>Q͜4[Yݱ Q3.mnooiZ=SV 9?oRϱvL~6Uܠ:K(nz[7Z1ߕD+Ll;nhMsּrT6[3"jjLSr&m,7$U*uAyR2p#b+w'M/Ÿe3Q:D_NG{S&\ԬsțTC 𪑌՗=Q 9'IQpq :IuO'[6]V\gь᎐H=ؑ"j=bt3.Va<.셰7xW(}2df@>zʰ@k83unWǬ^-#&Yxʰ}e^NINYX9h1y!H^!(gKjTegvZzC t{eaW18(c|гa2ُ1hDaL&7ĬGD"5y }Nc pX 1qhXs\EZHPR`1 ?倎s!n1jyWP}WG<([]4 }'͊G;$BHw*S|~ kJ}= )]`AsvC\6͊5)r@*8DBedoB푵cF%j~Rᶘ6w)lߖaؖ?C0 J3qST7DhR d2`ne3ԥ_f6v2W[Y+mPm fsT#P-ڃg 7 iUNn%t$-~2ж3`G#PMCS$oJl|Y`K>["q P[nB$-^g1po"|YB!-!, ;Bk2UƖF'39hp#'h*jEJcLeE.8//K&4D1m'jHܢ~G|@gb?a!!Wͨs$Q9I̽Qp渭Ԝ_{p͛~0i Cj X(#2<63cl#J MDdjSڱ/gpXVS`!^ĺ䶄P.}Ed_pnBY\ +wWN!nCxGSx{EH@\ B|΂LSnb9Ait EWlȩD&HBD`\Ā@#lx.Zkm4[J~bnAk_CΪJFT=R<ܬ톎 xa, ٜ]&lA>*aH-':kJv@= OnmOF#kQPtMUm)5mf `WkOz%̅65?߫ܿD\u"{o7h$EVd?oh ͷ*矀 чI[Uf}Uame-eknNp!4 LÙCܶp{Qxf `1B-U{X``~f,H<H(;b5Ξ9눯KEMUJ!K4m:M_ލ:Xgj̙Ko1qOLu+irw]]>_qݣPc.)cޅY_X>y#j}*I4ɥ FrAz@hɽ~\<ĞY_>>PbUarzY &ڨ[}U{[YL.-)J!a׾/Ѹ,X#`=|8;~`(LlR$Re?%7 4Z JLMX".@mMZok6ȶZ<~~0& XAG[8 ҁ3Vn(sds`K.s~ lm(P mXG:TͿWJXA},.V>tkR11j%{n,;;o[QhE8Bk/tg\#I[E0+6e1̛ O,gj>6 m1ŧI[C{Q_'\d>2Hex0<Ɯc'D,{;G?W!-52t$%ڒ:bzΨf-ujeV%f\[44:oV̀l(Bn"1e~1dg9߳ؾcܚstsFanw48/%q;:5}u%0[t;v$gI0DS%>I 15}ŷQ-%v^y?X 2C]vg*ޥ}bPgި "'QXxd\q&33 1Ht }X Yz&Rnu)_谨ዻi+Ek92KrX ŨJ Mh?^ ic¦[hZ^j@9%O]p3ǘIN 2mV/.[KSCnU`ꎋ)kͤN^ 0y԰YL^Qa;G:6r,EA_R38CW ږTZw*"Br4g-ۉ]Ɩ-u D++5BQY/U#(ߍ^d"7<pqa4^B+q(=,p ܛnbRa=_vo5+=  yEN#aB4D%2_-])yEkbwJqQ-_5S (>YPt?NV" ɚ}x2K)'Z 9%wvq:Ůg9= G{pEeWʗ~oOE44- ,]=fӰJs.^2c*8 W ;qd7]ZֵTb՟WԶaY5y#k'3u ~Go7Vw_m*:wu<.mi_ [lj[EFƊNOC 1=͗nB^tB];m~biY+ֆbQ0*%ߥM;c XsȊHD[u{vi)@ž٨G/U'f u61IxHJ a~Yi(}_KiRAϐP}e qo[/ 3C$髣H+݁K'v$kZRc(Z϶])8pA@^ѧ<IQݤ졽q*TKl20+QʾiU8ȍ}͟Y'P06ES!T^ C6&7.}(zY`EgyMcd`~W-^4M'eopA9 ag6ᬐdR?/',Sl}\+?& ~ ->K*Ĺ#$}M0;WQd{iDuy{'UÊU-z~(;PWu~iGlQ(`Ji.,DyAC`P>~'f_Y!Et9Z54NNZ4=HI@wbJP=:A@׿NU| "Ҋ 0ֻzz`QvdlE n>!;.|YrHg$VA#?J=QN5 #?mI~]C'K2M]VC:l|IV-vh. @ GF*GHWRkΐτPֹ7\­} 4Y%cT1Mf>K?Md _VuLʷП%ޮ6aԄԪ6KNJ 3Lس-$ۗr.Ϲ*rJs$+ S!kl8;8ۭ6s's>0)}_H$~ڂq'W@E}%ʊEºoUWIoWR+難0OOSFd*- 9_sщe?dgi5I`HL. <QNw١秎uL`LŚ܏:955essJ{{OEaˬct 3n4ASX &6G]5^HHl(-m Ujq竉>8y9^xPU'cU6(~y>m͸GC `#3xrMM懼mv:9Fc._P[@3fTXK\&e TH˼o"5wmk^z%OIYÏ\[Gy[rnQtRb[Eţ-OFxmaxt".G2BYe M-σi,W7˒"^;-P<+}n6$5:Ɉhو6#7o6_)[ j³ W`~03bU$uiq*:nIۯ}ūk1\snpiD Pj ":r6yqbI ǽ[fsdDa[>5rׇ5rw{"Z4|ͯ`b] BA-+钞e$E7w5DN?1B~4aE2@rVj;P 7Gи8Q[VKc g+;) NB6eDωf=B=>/"g)hdynZ`kdGaVtuո|\{}uOU*m@ y=h>BX0sEϫc/ƵV5{u(; Kb.`?l9u7 ]08Z ҫ[k0]jv^ᮃ\6dYĨYy5/hmZv>F1mL5Um}ETs9HG`|RaO 2d梗cpVU&3/^zTp.mx<[BÄ́_1 ~L?4igBV> e-FDh>(D$Y0s5^J}h Ӆ &Pu%5>3uBf"uħ B k t36yAY5-/u{;u쫍Y˨-_8 ͠+yfA<"L\'u,xf?`*'ɱقz9٢Vh% w κf:x!WĔR&ע+%0;N_!~qA!Դ%Q/fq™5m$O򧤴pYyJkUegYlmQM*垀jKi.DVkǭ;Oy$d>΁xi Xv.)p;ɀxNuh}@v4cvCzx5p*jfpO>뛾GJ[~fK)z4,Bb)۝8[U Em*286Θf4$XXuPiG4EapßY ЪZ pa%x_z3v|CƉW3mnŤ+xg#"1{YMJ4XY!G#)qw`0<3쓌i?vV%$ aڿWb#sbxGbZe ceM+bWCA2|,aK^A iZy(c%Hj̔Җ5s$Oby-$~b-X1z/J$" `ު (}VS-B}KSrOl `[䪨Y ?w[,o~KL". g>ef|gVO]ȬB\d~ bY6=޲l&5_ֿ}wǛRV\+.YOͪ,~FA,YDl Ly`=q f> k)H #\<@we}!E4E%>.Gǐπ`A(!<<*x}.9c}ۀzJ;,*ڎoٛ}L졎QDox|,)YηO,.0[dN0*!_Cu ag31X> *+p?B4'[S1$=CN :X9+tA1=7%T|Bs(A}G<lg!S,&)&ۆL₊R!" g03Dwd<4UV/_,l#IK~76PP14Bjhοw-%OJ`g>0̀ؔ[!9/ vC'>w6[aPWw?'٨\vqJbf/d^,m jXpδ_&(&z+xJ d, jB}腈UPjmc˼5Pd~fbxSڟ| sC6Rж>X.s#Nc &O2HaGڟ z=;hJBf$EtřIxO13|Th;IL^7ψ@ 7 1axifv179΂2&HZH#o&R;H7w%*hA)ӞM;yeGeA[&I1Kh_b!8 /e\t8;[[ֺy#T6`-OE=3JTG/z ) 9ęqs}{CvyyO)xN^ o.I|,Vt5X'V!yCd0К* M]Leix08$]|*,AOJ{0ߤv+wKPa@?!\/>-h.J(W{?4L,ga"e9`~l)vߙt@D9:jB !>;^<ߞ53DJ`| .;Mb>+ `ֳ.쭠lilε{eq2d4?dtvDO:ĭrd".0ZmcMXoiE};MI[)%PFO֯zݙ&%9Zḅm2}Ǭʎe"n g'U)1HSЃ|bIJLd!z9m+,3_?f'x1N$~%T2Wp Y DTc9AKw**;g& xNWde,~p=xC^$ͭP0tWNf%_Ќ%~_b챿B)_~=CY" j%k׈T"3kmAqiEw"]ef*χjZj.)ռ_J kxK ި#q-7.%cT6jqZs¬񸓃fQК ^m` !7@9juvSVza `\Iz ǥx2Ĉ*"b{t&gڝI%HJ ^-2E`= ZX$=/!b8FV/ǾR0 auz9x_&*?[ȗu2lMp^CG wc{ O=-Rg9DAk]2#",t/{ b{ WۜL8dG;$ǍoڍOrڙmǸ6 h:{v't"gQ{f~^qrfо٭bAIYwYf&lGGϚSMO?GӷӻCW3CL[FkSc%;('uAsK7Fy9zuz[iI1Ꮳy <>Іx+jE^t ~%a굲=y`݂wѾ)!!TFY'|Ux|V;ibقc}tQ}m[bbDa-UEE9{@<-yG[x㌳ xxb6|^87LuӹU`< >ɳa9r1󸖜P>k>YT'^styܠ0(3Ni1`Rcŷ&/4ږ,JYmӒK;N::3\na{{y UQ[""\M?[v:vgtHBg*IMp |&)G V-Xd鉲+V~UcZk[Zהڜ(lփ`p BB G1iF -{/)s˓ʉfMI.H)E*zPW{kMGXgq[3{PpfTb؎ +_қ_:0X۹nmtޔn kfu;~ĻS,=v/G\y-zč𛡷o}K-zlO>x.}xY*on=c'Ϧ_~9u÷?s~ycOjtJ]?5\k2F4?9o|zAew; ڬQ-gaϒޥ$b`ί]Nsku{yFy9x~swߨ* . u 3(B豘eXV>P♺duYA_>eʹ{-\񂃅{vo+Zl[ΊVW{h75h<,^#(){whLr!/R49}qq.RI,+(JjXEsZO}GdgI[۳B!|dvxʚ ѪɻSM;ӌlƂM͊-S[o{lg݄=={{v`!#'~9|"$Tg[p>BE꥞[\ oAޥo}yH{8O?|Wޘyv߻}?y뗶o]q̜wf]C(#Cs}&-}y8bgmidm]"EO3 -9!>wG7 k}p< * ÆEDDD/1Uݸv'nJZ l qшd> <?LXOOH~BA[@d1YP6;%4s$JA~I]Nm:;J=+zÓ`axh1ȉU;'N_+^aÿ9$ټim '@uxNrSLxXHckO\99wLY9 .^ȻYs rw<xy׋֗W7䷨wr?&| ׯ^}ϻs~=ULinh$ty^hA_bijyΪۺq·6[mvYXڛ=̭͋_^ᡢbu ,p(|"ּsm'ٺ**GY%WX {k8x4ٛYc'ʼ:P|vf%s;xWJ+-U`vnA#Ѥ6H}`گ2}fp\&k`Ϙf5vbAX\Rg$Wl?,ѿ={iE[0ތٯhcz۫)LDưJ,DE?/qcYFf tػRB3G nnd˱mWb+ vf?1in73q8tM# 䴕4H͜7rd3unHfyjCY(93[NGcnt^>4{X!aণ(V0mӋ͉mpGRoҏ=8&u`>,գ28S]@/1bsc*єa?W{K?}ua}Ź3cuZ}rƂk-ʉ5E'f;{+k$>÷OY5 W c3L: =[éOqfJ\2Kn_/-mtޜ>$ )*r aԯ|ȍT-n'lAB*._u-B}A <_V\GʕJW \cIeb/;a?g^p>_azc`:oV.{kVkRr] B9U\knpQ~R y^uYk׌t{ lr nA|w>'Kb~~8u ǝ+s{ӉLnHf.ע`T}=^CQC`o^\{:w75 6rSnjBΏN*ι̦M]zcϘ('=uo{Dqsur^Nur8MiV\gώ}^˹T.) ݙ9uޜ1uN '~]gjsckk.(϶NVJ^¹۲ !mq<縮I/&FCك}fqlU'@v v~^%۝n)ΖCQӜ]`A6&>΄iZ-}e7 `XHv{5s$cN-c]& %Xw[ݢ3‡~'V-,B\H5%*$y! ;E5v>)U@[L-g*$Z<+N)<H}pZItia8/ApFT(0ނ; j7 ٗNPۍUfvKF}#Qa37B;ٕ >1ܧw\(&4B9-l-[R(]tENm 4aJ`DE?U.CrZ^yjȱCw+I[@ёqdgo7_]'xY,kʙU}ܗ g36Inv6_Q<>j%as(T@è¿ӡi[c~nW&ͽ.{3~󕍯6FϋN՚ LvA 29j{biR5g)+j'{#iĞcۖlfhLӝ.Hgтl-O!f{A䳖Velt%Gf'nS f71/ ӑٚ,ޗat^j5mo峃Y{O tY Ē}*0l3Z3cW_~ۻ"'۔gڷ5Ԟs#V_w>bx`7RZs7GjLojs=4`!_)_lhX"b/^̑{=vq3/:oZAmz/QS~*5E uMuUw+)'\za}{?_Q^3$SݕTU($/]kyY8(y "gʼn"mIƝ&{h_ZQQk* cOv_z@RI>̜H. z] W]\X쿭؉_Ux[~Vk@Y*]eCfW)̖z̿ j?uu'ͻ}kv =ziGez6Q;@%U6KDQ` o~׍ܨO&'{y+[C9TG>)+v] n@/kQ⬷3ɱɭ;Xlj JvPRa(x$}En#R(lxڽxs5-;\&#U9:MKy(a]雅:$75˽yǛ[lT\嫊y+WY):#[B.^ ό-/O .N ~t=<U[=ߚ)>;Q:hR$7#~Y&ZZvO;b%8+rhq+|/)6a7'C흾Em!=Z8Z]BO*Fe鈃TNg8e?bo'b˺[):ē:5xP"\vWM#]5EwIwpUo*EϮ3Lz3uH"U#ErAdbep#d uMh[V5MB*ii"ק K+Ԟ Nj”=oJvb>ٲ|qV'l&x#&[e¤IO}С{WG|u AoAͻ \oʺl֐51.G &&F^5IL7t]^jS'{\~ػO=#֤m̷W325n{YmSbNwE}ewٕ҇hh-} v #Lu ,enЖBejٶ)7'xN6kG׸?9HAwJ޷WN%;[xcc^yr=udoʮL >8@|Wz #fFJq*h}gkhQZ,'+ ~d@`6[)5z'/䠞K j$J S QϗL: ҏ2'a+|z}VMutU!NmV.SNǒ9P7)]a&:.ܬ=6x_GZg ɀ_i÷МՂͤ`JQ@G#^ njO._9~ 74+tw 8݇{vGvj:Nʋo䁪ߒ.,<$m\>Y`a#>Ъ1xrC0a[ku4.yMkdW5B^H){Ȅ ҴQVX٣M}:r%ЉVzeȮDLfrNTX%4ܺB;/jEӭ%ٵqu+ckx|ius/DWYf1q}2G+\%N6NM<:(qZ [PFfy'dB$=YCMnW2# ҎLR8suJW ߮vau w5N:߭z+m-xq?  <yq'2҈έHzxm֚jURGmX$;7-EK{FEaUM9֭τ)^ՠ 醑& MLm ޜP7jWByCO; ir! U:HsWb$ nb #Q\_qʩ8pn°Tݾ¦= }?5%CWrϸsi)9C.q&L>$?rjptS7G:vy6`Jw}9ݫkAb&.XIU_ "%-_VWn~N_yt5GFlIaHSVb lIL;-uf c6 vīk_P>ov&=mjj2ڻF~!,;ܰf`+cڣg*kl0gG~h-ds=q3Q`?Tn-.Vxv:bjR(%U<*DI3j: c&W;xЈazy[A#50 ~M9#w HQ:< Eʵ'O OȨ`];xVNc;^?RTZ(2A<7X=Sfnu“p1p~a?Kn&G(,bo$3axӰU&o"NA3վ;pk¶-gWjg_݀b4̢iY.fZ?'OB&;B.lmஈAuykG@Ee&/w{jtжafj"Ċk!C}+< ]SU۶dUoV e=MPc\ UO2U5*͆)ƽoG";sZ}kr!SXn=bByF;0<+xK6 ~e%]Evt.[:Q.li*+xP<]F%LUW dEϔ0$ҴI M02O~Kc\}K9@XD9^D(Cړg5pF2\*>$z{VFd!v0錐6 0ެmhd jlv2'w@TYYĕ璇5b ^NѶAriwFںG]D:,Wz>tjBw$=V8(;;:$_6Oli{L䐐>/DWz͝w+jOuN&mT/T!QHMWl䍻yv\nJEͰku΅$qW*bR^ǻKKm.=/z1ml흕PQG4 >,2w$uohoQPEɔd_E7Z'Pϯ\9ɜnz460z3tt޷1ɻq(Bݭ%)합m)5tpMOk 7"C'Mꕸ!7k~uAohUKi=日2w8H)asˤl;͜Yod~o_;–4Nư2cV\f$qzހ N]*o\:Gsv[˶vA'fx*Z$ݫ=(rrPuy?vж:kCƤ.k꓊PR<-' u2$ig|(@.`vfuWm8?^Rp5MbaZ5- H H#!"ݧsާ;8ġCEv{333kfU 7W=cDZ.!y&g]]]>zcP55MqMq?f9W%gBuv$T$[}$pTOn9ҌF^ԩtl0bʚ))du 1$W!bJݟҕZ1fF /ljv7~g51M%ypmJuRSH:L4Xc#xi1kvV]:wrv^i VWY>x'eq%h+O]Ը7q:8vV.P\9٩]O"& 7x%0~&ق+XFc3X7N"٧r8HwQR^ @.ӹuҝ#_p(.KpibkOk8Mtp'鷁,mA:[x<ȿZ,chg5hX_r~_w:֖irw|9yZlF?,,.ؾ:^FZ$~`F A-X{N$ :Â"S xə =).c8102*F6ݳCˢUd(A̹؉$Sձw+3,Fe5 JT:΋^4sϮ':d 7GR=1r|LqKU {Rզbs)Tr7qP ЪCwo J׏Lzy8];ވJ kȢv*2T2Bx8cǮvlr>%>؅aRxe[ڧo&wHFUF>BsJT@ޑC?oõ߮;cȦ;\Qf-F ?aKf?<-eeR0g6۰2?سYm}3.ǚfR8]p RސB{|j s;1S|=qamEZA+7g ҆5&-tWeϗO|Qb˸-Dc{e7.eU y/ST] WPVZKkI ~ S+{Y|F]Ĝ(2%<5kz&ʢWJ}שV]K{Q[4UBUZ{J﨏v[ uq|{/Sv/鱧Uϧm*+:ۭ!(!#J~{m0pwwx2@ mƮ)#K5_y9ͪcbemO17Q3^0$mc<'d '{(;S΍4#Z$bFi ޠU;"ئ0>.& =v)g?e)sn7q/cؤ™mvdzF͜u +2L]g5P/Lz/~ he' , U= 0d_w}f!wSOr{ xcZq_<,;p"zrWD9r@Ժxn `lh~855<9^Nx_ tW :Ӄ1X¹Gy]\rj8 0$;NrVj7z!8TLxR29aȃ$k;'Z7p2c.slLQγ/h}mIsj5RDzNѝt}D \;s~cAl:NbӚcoaU v0JE/vgn9NFtIBϋlzC۽'CS#vZ9rs8~_ls\F̫-Yi*淺Y+5FƬ)b]΢^XST aOΛ_'e'6`qkǖSm#eؿ\F &J#7; eLMڴ;>=n瞲qo\oSCC,bw$})IѵD\ *??Rh5 `.d!!.?IOaRxD`6\^B /!%x4W*~ {wS!I_Gs-c"bcxǔnG.M0C1l^^JbL8D\l/ )tpjTdlą9)cxbġPi9o{yiz ;R vUPw{qtKx[U$ *81L$U0ۍmg'~F ip1Z -XDpx'OdN.΢;q g].AḂ-lSqZW>*DlRKV°PGGUPذ).pVGp!ag纕WA}UA^q.vz T8PP$v~|4*`Ym `#iI/O7lVltKE**+LD۳4Fd/&2rث"__;cKI6e=[C8o.GFv+.n5fKj+yᢚFvIȟEJl}#1u~=58-L mE6. uхx#TՁ(W,Mi1Ml뤇>YؾWEȽV[ƁxdS4݌F7u<֯n8Q__H9NLE81+=[ld;Tkŏ*۽F<i8nF?vzKdi -*1Ј!?#ͱ_+ ccPph rjg4GTs)͸*CKWng=D3b6KY4viS3R7Ym{:H=H Qs i.Udp#y8䦙P2G-ĭn?|F"GU1 =(Sċ/{Af^!Hu`8 \wn`J7?.X:: g=p^:֒r\#JyM#Fʡ^v-קTSd2CVS;Ȳ+h$N0;T4 ߃ITaَ?lf$ךW/Ԃj_WɈ\$=+TVއ h 6d!nSM.u {⟪۵))_uh ubBQ,Btŵih"c=Djd6o}$W.ԜJTu1W|]6C VjJMw*&絼X*maךm:) 4Pe'4&54(.6ĩj* V*c75!@q"]oί#W?c&?q`ЬAj:7ZV&(Bm(V˗ǑZpIxsߕ?mFF9m㲏|x}dZ+TT_RO%9%?"$=^7=1뽛}z&ٝ5/Z_Rviu .RݒXJmDȔyX1!0U؝#CRc}@f{/6}qʯIE';Ab[$:+y0yRՇAKkyMeLZYmO^7v4Ԧ h&ze{VaSͦkYK6Gq|".ꚞS^6׸7E֔2W(n҉,@`1[]|+*2d&5-ayX/npF ?t7$V*xU$j^tMunr/z߫,7ur[}L^ nȳunݠJ0^)Zcnd Β {򽮗x|u[P7-GO%Cm7<.E>*cy8:B2 ' Px$ ?K<%(Z/ |262oԙ7ȴ.hu_d? i O&;/ȎhO6|ω/U lF|6(%x5WP1 95GH:sgI-7 t$Ck.> T!YÛiľ C\竪:'՜{R0Gu;G$tH%NDDw C [6Unٲgz`50+;c$a.\1݅!Q^c9l>ظ]7uЕz)oãfETI2黍f rp\X'S*fk55cdw~?%|dkQx`+H4uyaAjCacl)"ۨ _c[mGF[?uZgWMئ:H^Pyߚl^iVMWWX|xt{lv eAVM?Oop =ibZ>mz6L!VI闏<@wmnd֌d}L\)ujuZe׀4V=?Z />l[;6 ~u[  |m*.kk׫wW>K N/t0kny7kڻՆj|-[Ȅ10jn ] O3(P RD9;w'O7󭧌j%}W4<-\'֘bU1yx]iGV(yT>#rtQj S3ڽSD`;:MWBح)k)4p1}J(ԃ9;ze_cX+$OBm[E/|>腂O3/nQN$LD\-<4޿$gܚo;L)"U51]bqԖib7Ձ*'t ΚE6r'`/'>%84HgR/ܨ5cdQi4)nj u|w jNg>{Di]~@MX8E1U::ݍ㋗OsX$7F}{,ΉNu,o[?Oļ(YNP`K/P)% ci7U8%# ΅ [?bGUOds=#K]2&*^/3gq#c n>yjRhHUbrSB~!j@}PF9HJXy3Z ʜڙc;InuvCD]r@mUv)4=Ҟ]`eXO8[_`Bܭ8ԏ[KZh 9 ̥UVRT\^GO|Ch1qYu2qhΥU^-҇a|_?4rNśGLk繇.ZgQnW8u"r#FÚWkdH]+UdE]BP*s6QT#&<q}S>ǗT<<<>R_9ק)42@h~]ˋP,[7{Pg~Q崿ҩ6ҿn_\s̠bL@%~԰*hud<{q,I딣 p:}H;.̧=Sɹ\yT#4aWJ^V)UrQ- lZdC"9cq V;+۝U|`aiwYGZzF?gogוneocxL=nspz9i7˜G[d誑 H~_|Bf͊,zX:Ulc/;G%m \#G<`e 0 42|$űe3X ir/L:PbmKORM?tU􊺯z%ȁ?rN6ə"ђ r ~kJYܵZm>}vMEuCEkRMSA5H fN6meREK3x5V0 z>l! C{Ŵ]ki[邩Fk$z_ K-gp9 ♥Ӈ_pgunũkWrp83^\qgQw%,de{]R?{&;tS>494tIΉ*Oci {Z*16]3co}wىP/YƳg܃#9SΌDY +βZdc/T*._[Y9NI<4p}y,cTx^vYd֕IqYj SY'T]YG$YŬap2<^LE`)$b8uu;*şDp f -3؞z-Ly._0^Bfqe*ǚ펜a '_ FlZ(chs_ 8 ~$I!=AWeH\  `J?PR-`oo1[aD }sӱ8d-ڲ++82!`4u>C ({"J~wMۍ9H@ra9 =!.R~F8 Hy0:2>W=M١e'$H*MȹH6Ȝf<ٲ+YԞBYB>X„73\)џ-I~?n|g!w%vW2;}N2ZN(F+LgU__#œռ?90VؾaJ4"‚6CF'4x&nۖ{`k{UI~pA )Wqys4kFsĈ}ppOTTd7m~>Tnwh1 = >\67U3 Y+ * `~[AJ$JtsZeM0vPN+갖}8\,S#v"1)G>EՍ?_O` ):yڴ7NUq鶚~(aC'a*r1K-YQqVz;rMjz 92-kt-%ǁ ux  >2b70@aҙք'"`yH7_CŒG&O(x\0ES_awi(S.@ukAOf H6i5\gat}Ā_*&MTg,Qp,:wg<r塗XF^! 3e x  tP+OmۤND:(:+LR<$,,M}g' [+BcWW #HJ6uJM:um4ԍ=Z_ j(rZz$7 y\>4rn)U+N5ᲜXOm"7Z^\;=Ϡ\>rS6(@`>EƢd[E Ek\οS6~6M_,=QZgր.X^z8^.TD+ibeyQPx ˗֥ĉ.13+i ֛3믫Fw;+LG.N.(ƶ%eL7z50Zi%Ah .XnεEi$Ӣ- S-؏2cڒRvSvye3Tc!^PghEt@uᕞ'6M?(E7 &J̄[ !`薙f8#&N2z*Ctp+h  QV.|)j-wi& F?濫nΖsbV)xfe!vn|k?T5lmYRMQX핊H_ޝwrqڹa*?C>A.PxiKZE.2^H%H*2hLs;@]v@W4Nݣaf͝K7r{Iv+|Y|&%fPaASwZycm~޶ﲿɒ ‹7`[/l3G-yL[ruXÚMfm)i SfFR}׻[vKb u)9uGotYSessnh͛S/7m4VOP^rJ'D&}WBj-Ǚm*ŕ7|4?d-N92-C.b urV'L dOʦe4TOfskV$ 2.DR&1ןMdQ]lEct FN Rd1;=8A%u}H~9_/s\~[ZJkAn -ӑ ڥ"qg,j1Ek]6fޘwZ]ܓpCRlt^ #[5цi_2ӵXCi\ a/GQ`ẖN-҃5 ,EH-iNb"&cKA"l(.{QJk۪c$FXV!/$ژV.MeEf@,Lex:7Q!8;"v)gK*yC8#vqms^m :'e2n6v%W4\$r{G80wu+ NTZbj8+4Bٺ ܾb xˁmH4_mCjz,mB}t%&A7PS[hޚ >?0GcZᲨ?m /;`跺٘p-#Bjԉ wZ2T͐;{%ѥE9c[R F#4xU5K*ۍZ]AZO@To0镨h;J綼qm"K>ߍ~ V8{ʼyqkDZʣZdX[MK8*p5= ٪)kQg4#T&'=! ly`?Qs󤩂:Aѫo6d%NW7Dm׮T 2QJz͖f)\ 1HEqSOuGuIC˛IY55ٚwwS$$ W 7Z!n3t-*լkn|t&#zVEjs\2. \F+l;rwjEsO)gL%%mS7>_nvU+cqg̷V(v*<(v̞edMo?+~,ja`it?]m&fmbU13|zuW=V.CμJYy{8Q:8[Zr9 W~7m\b_*fE@-Zs52bph<N_C_6ÝQ/I7 |a>,5('$Afdޯ HOzr-{fK>M=}Z7vӫb{\zk~_[Bzh|xE=ۖ5&Pj-C7"az,$p. 3F U6.ɹ/dGiO+aw8n,e01f Z aVX1tjFq]UMa%v[1n#Մ"$"9B׌Dߕy{ՅN AiZŚ8φoʇf]S47%DEp}x?ۢo#{a4>s]C}Li;_MSZ0c_6H7TV]!N_aq  [4氮4Ovl[Hg]󴰖K] 57tkt5nrt}xBcMEb+ѫ {gW=رSA:~h.H䋞:u;j]lYen+yO+n}׌{eAе3 "ww1n~k[\7KYφmTc"Ӎ \osE9Mop2TN&G]#Qp t북{@)!!B!JHD~x(ɂl?:y~jmY?͙U̓f* {{<xrʾ Sw%g ב]0(%CgB{Yo (2foeֽrɤ]"V™"܎ k2+8.D-[{ղABI1S]F?۵kϝwym318OGoߑ^p߁_nJ-R17Чᓴ\MԹKIn7AlvPЅO4:rhN^h=hQ:\*vR=y- f!nCK=s騨9olTߛ5X8@o*k.&J awĽ ҭgfGRG HHMk#*7QN4Qg/s?U K mU;oϷG-FuЇfK2YSCX<{si%e~ab$?22}RHT0Y\pQJ7%%=R^{bq_Zqy\We}?ǦTL㷎U6V4R.Ofa7( 4" _N;Gzѯ@V_JkTG\( Q*Be {+%ΒUUQ[J)h/E~{fLA؅hNVCz<"1 ɕMe5ʥ+=Kod*PILͣaciOKV d¥E,X+5` *,j G+3̪:uH c rI͆j۽/hEbJg ;|k75?Tܽe% {)9)=x]acDV-1oUk=ٛNqWnTXjuH8 )Ytiyie]-KC iΕKUi-mIHu'CKԏWR3sf^rfzt aFefVVL?d1_U}dfّK 9,r31{C;^v͸a9c Bz폣khMu Q`=F c/s.c 0s֘=rb<7Z &pTch>N`]ȼ=f6XeR,d\BuտisnK+Eo I N~׻},xq*'LJhyTWQzIpK#tԦ>+<$d&uc ,MXӡ $^M.rv:UcK)bԵ>? $4^a8js,қ7z}[ 9OQGJMN++=JKh?Ź8WJY&0ݑ_GVL;%iJ.kBR%Y5͆S+1M*{t#予r;1R5sˆEoRz[1JǛF*j !f*蓤#.o7-z|ʑ}ȰU1$9ӻ"Ũjuʇ7 ڋA~>\h2eWwpuӊqKg⾷K٩x9y4V*qJ[JF`\i_[(px'9M""QBܠJ(ʬk21Ƀ9" =~)Zb#=Έn Zh$؁祦_p2EJc~vncy,LY91#ƒA}'qv>Nsrnh(fHjg0h-?313|,0pczw~_{~qtEA>ۓ`Lo .0\/Xs4xw,ŬX3o{钝t`<}_@d>ѫdI9 qnt"ؿ.TeDŽ]lyS4!2vʔyC*s1-h"]1y]-A!<* ߦSP#cMfh%s bvZ .c]53s;Tvi\bgVDLLg1gBٗ-x-kMQ\zNʝli(ދas$8 T8D'[@e쇦O@3dpY  ]#aJ(%2A-} &( [HN.ɸШjGs 8b?^`TlX Sڹnf Ɲ2aMaH4PZiA Wݧ*A9鋴 \X\ s}8xk 8[gdktbQ=}hQP .2i=MP41Ν\=Q.e5'[(c e?n/b{F]QaKP] rrrMwqtGO|mBǷBsS|o@/:j!^ _(Cx*yqD%1(E>a͡z@^9eaB6lTo#O$@_eV Mv2;O?.E{#n=$x kNȔ}k@xynclcQx*ž[&-=ӑZreCqȆj9M>"9xgM#3_=W`? mR)3IDw0kEx!Z2>"Mpx,uC-oų&WPY%!C ItN`1>*wXt`IuĴ(/)@ [y 7luyirZʃ/+'AB{eC^=Zy@(t닮l$~w8"kʜV=J"5][`vyBPVc^koyL+WF11>hD+K4gA[BL.-kBAi!gk1K,s[L_pڰޥVQ̠߱=F^ueGRICE<XB үB2<)[]*% LUΜ%-*X2(Vʶ҅#$W+!<_jO\J_bw8i< )a 5Rpwy;o$)YHJe6 11`ư'9d/|܂ ,cަ, Yo qTvYp1~r#ÜjnYG;*# {J"b@NR=7hgx 6e hU3y 4x7=p?S8A`oAho,<cdJtbw  bMlPzB䠄gbGE/ߢ%~9%pHF $dH@_u277OIz%(mS e?$7!ч-l먎wǽ1Ưڝ&9lGDE|~-  |4qyͼveMJ[X$%K1W1hmM=l|qB}Ҫ?Uj8,D~-p6rURn oαk'MZpU)u Lt&MdM˶LO-zu@ggىA9_Dl:Zaą/;0c,4Ohw!v5զvu`[@v 4ٱD" cU;5%ΐv,2TmR$:,s#yGYok8sM$fc4c$޸ΑdAyenjt$i$dc/3\xM=h.٪9XL=,cڗ)W0bdYS$,FS+vB׆<0JEZU#tG1=+WhFx=X1S kXGyDc%nF#6!Rt.OӹJr5iPX#6oH׾&1ω[AV&t/Pj=#ZR_zT1/FqA&[Q|!d^Ow* f`T"&Ryޮ)٫4WSJOJK^jԎ Ah#tz2}͍̒Z}|U_åZڿ9fADV*Cq~lޚxJ. ~Y}*&s@rʲ(yA+ ΠGlώ,Ao-d~gC R]q&1 ~/B~bܟKP;i!$T0p:ɪl(C+ZKW5ĉӿ&|v D01cԁ/ as,:XV0woV6T<\Yj=d < ;C$]T׉xMlo|8.AˆȜnff3ڭ[P]IWʣ~we[ś EżMGqsa|o4)Oi:=E?nɖ4ݬVmp;erN6Q[w8Ÿ^d6KM-?sllT3s|+{\~M:t_*J|y/-.`a^KU`ݏcRb›}C [u;(w]lZy#T+2Z~N8ʿء?,9;EơdLkrCVv1RLhFnzOd>%ϐ;:D+s?йQ 2^Fl`By,_o/e]#4[%n\F$Iǹz-|.)ԐU֮Y\qp%@YYUwIYم]=hִgHl2ymG`vȼHf teb$ӊCf 434>Vh-Jom:X >k2O T2Y^' 3͆p7 .y[Q<ՠM+Ijo*|Ktx9o-ݢh^#4`0r*kB6Sv>)YYݰ 8fxsU|t!z7E FQdyW_NHKlEԁ5F)o<]ZVJ N{~-j-usV?ό%, }B쐝v ˆ֒{m) kꨟw ?Փj5Oo9Ww@ߓp=cb錌؅=K70M{+sJRy)#&y\^Ud?ݒu{,3@mi\ YmgqԮX3UcZr2)EV#zww"÷NOx8 {s[:)}Dq`h}c@juO_YH̴Y)A0i<\+Gik& .T'gx(Dʮ6%'֋4SǴ{ք*NظLi|l5GJ m<fݝsќcAVJǴAk"d0evĢ|ȷ̝+>tE'jׅ6"ɵ2># &F1]e"v5"92H0ZURW%z)ʧ;iT{Z%jCE꾀-32/f>0)#1UdjrDXuAN+(h3Ro Ee/"r٫{^}bܬX.⟨觫no78s+(,Oh:g&iAHϮ- 8GkKq. ˣTd] jL CC.Pli[`i߂oݹE{ :%BL{`%a]^;EV%퇫*pM_H_З!1"s=F;XZ+ƓyڣSoSVT`O%)Ѿ{7#6 yqA -S%5^Ymgѝڣՠ Th.啉ҥUD~T2OwF]s-hmȶc@^{ѯw"eEORa.RsZm[++VUL`CՇǰ,%yûGoI(jU.hϔhb sjvo' W|jzX(e&R 7QNOlb, 4I A.+ǘY-?T%2sF搬-I/wXnNJK\E%dRٱ snk1 9X8+n!CMUc]d9Dp0 J큅t gI@YELÑ~H6W  9jvP_@3JˆTVGTܗK*_JKS^XYqDOV_Eǐg:ƞ+{k*ļuXDѲ~Rm*r;\AkэF d8Q>Ǯ=_7,W4,H&zOB#<'ixzWDl$ # hVQU2M[@}*;TLHi_"ύarn3ly8PKl.oJ!7lVNՅ AZ5INGyD55q!̠E|^VW^FjA?DS7Y -7`"#;6o򔻋u7IK22Aa "|EFzft e3?D,ng)r.~콦\{Nr+;@tHq~U?8WS9CӜ.`~LrpL8ܑ Mlo9 gPJCn$gAçp޾Sac3sLRZ{F$sDJZW<`'Olao&sal6{n@>e/`=nd]Q{ ײ)9uqٯ߬q:Ŧ=Gasx5;8lg5,Xur\+7eyy,XŒ *VѺ$1 m{x#D|>Ifhә]Y]CuBtyS#tl!!L?(`jno%y,˲riW.-ìY[?_V<$dF3]`"ii\